Home
Research TopicsStem Cell Research at NIHNIH Stem Cell UnitRT-PCR Protocol
RT-PCR Protocol
- hESC colonies are collected and washed by sedimentation and RNA extracted by standard protocols (Trizol etc).
- Up to 5μg total RNA is used to make cDNA using the Superscript III system (Invitrogen Cat #18080-044). This is sufficient for 20 PCR reactions.
- PCR Mix
cDNA 1μl 10x PCR Buffer 2.5μl 50mM MgCl2 0.75μl 10mM dNTPs 0.5μl 20μM Forward primer 0.5μl 20μM Reverse Primer 0.5μl H2O 19μl 5 Units/�l Taq Polymerase 0.25μl - Reactions are subjected to 30 PCR cycles after denaturation (4 mins 94°C) as follows: 94°C for 30s; annealing temp for 30s; 72°C for 30s
- Products are separated on a 2% agarose gel
| Gene | Forward Primer | Reverse Primer | Prod. Size | Anneal. Temp |
|---|---|---|---|---|
| Oct-4 | cttgctgcagaagtgggtggaggaa | ctgcagtgtgggtttcgggca | 169bp | 55°C |
| Nanog | gcgcggtcttggctcactgc | gcctcccaatcccaaacaatacga | 426bp | 59°C |
| β-actin | cgcaccactggcattgtcat | ttctccttgatgtcacgcac | 200bp | 55°C |
