|
Population
Data on the STR Loci D7S820, D8S1179, and D12S391 in a Sample Population
of Rio de Janeiro, Brazil
Giselle G.
Gomes
Graduate Student
Laboratorio de Metabolismo Macromolecular Firmino Torres de Castro
Instituto de Biofísica Carlos Chagas Filho
Sylvia M. Marsillac
Undergraduate Student
Laboratorio de Metabolismo Macromolecular Firmino Torres de Castro
Instituto de Biofísica Carlos Chagas Filho
Rodrigo S. Moura-Neto
Associate Professor
Departamento de Genetica
Instituto de Biologica
Rosane Silva
Associate Professor
Laboratorio de Metabolismo Macromolecular Firmino Torres de Castro
Instituto de Biofísica Carlos Chagas Filho
Universidade Federal do Rio de Janeiro
Rio de Janeiro, Brazil
Abstract.......Introduction.......Materials
and Methods.......Results and Discussion
References
Abstract
Allelic distribution
for three tetrameric short tandem repeat (STR) loci, D7S820, D8S1179,
and D12S391, were determined in a Rio de Janeiro, Brazil, sample
population. There were no detectable departures from Hardy-Weinberg
expectations in any of the three loci, and there was little evidence
for associations of alleles between loci in the database. Departures
from expectation of independence were observed at D8S1179/D12S391
(p=0,0488).
Introduction
Brazil was colonized
by the Portuguese at the beginning of the 16th century. Until the
end of the 19th century, an official government population survey
indicated that the people were miscegeneous: 44 percent Caucasians,
14.6 percent African descendants, and 41.4 percent mulattos (IBGE
2000). After that, other ethnogeographic populations migrated to
Brazil from Europe, mainly Spain, Italy, and Germany, and from Japan.
Due to highly ethnical miscegenation, it is difficult to identify
and study the genetic composition of any given group. Using restricted
fragment length polymorphorism genotyping of nine variable number
tandem repeat loci, previous work (Moura-Neto and Budowle 1997;
Silva and Moura-Neto 1998) had shown no detectable population substructure
in a Rio de Janeiro sample population, when compared to United States
ethnic groups. Recently, using Y-chromosome single-nucleotide polymorphism
haplotyping, it has been demonstrated that the majority of the paternal
lineages of Brazilian population descendants originated from Europe
(Carvalho-Silva et al. 2001). Also, Y-chromosome STR haplotyping
of a Rio de Janeiro sample population has shown a haplotype primarily
found in the Europeanlike profile (Costa et al. 2002). Rio de Janeiro
is the most representative site of the "melting pot" of
Brazilian culture. The aim of this work is to introduce new data
about three commonly used STRs in a sample population of Rio de
Janeiro, Brazil, that can be used in match probabilities calculations,
substructure population analysis, and genetic distance.
Materials
and Methods
Samples and
DNA Extraction
DNA samples
were extracted from peripheral blood samples from 97 unrelated individuals
from Rio de Janeiro's population. The considered population structure
for Rio de Janeiro is comprised of European-derived Brazilians.
African-derived and native Brazilian descendants have been excluded.
For this study DNA was extracted according to Miller et al. (1988).
PCR Amplification
PCR amplification
for the loci D7S820 (GenBank: G08616), D8S1179 (GenBank: G08710),
and D12S391 (GenBank: G08921) was carried out as described with
minor modifications.
- Initial denaturation
of 5 minutes at 92ºC
- 27 cycles
of 30 seconds at 94ºC
- 75 seconds
at 55ºC
- 15 seconds
at 72ºC
- Final extension
step of 6 minutes at 72ºC
In a volume
of 25 ml, 200mM of dNTPs; 50ng of genomic DNA; 1,5U of Taq DNA polymerase;
10 mM Tris-HCl pH 8.3; 1,5mM of MgCl2 ; 50 mM KCl and 1uM of the
primers as listed.
- D8S1179,
F: 5'TTTTTGTATTTCATGTGT ACATTCG3',
R: 5'CGTAGCTATAATTAGTTCATTTTCA3'
- D7S820,
F: 5'TGTCATAGTTTAGAACGAACTAACG3',
R: 5'CTGAG GTATCAAAAACTCAGAGG3'
- D12S391,
F: 5'CCAGAGAGAAAGAATCAACA3',
R:5'TGCCTT TTAGACCTGGACTG3'
STR Typing
and Sequencing
Different allele
sizes were determined through the analysis of PCR product on 6 percent
denaturing polyacrylamide gel electrophoresis and visualized with
silver nitrate staining. Alleles under homozygous suspicion, after
the amplification, were sequenced by dideoxy termination using the
Big Dye Terminator Cycle Sequence in an ABI Prismâ3100 Genetic Analyzer with
separation medium POP-6ä(Applied
Biosystems, Foster City, California).
Statistical
Analysis
Frequency of
alleles, Hardy-Weinberg equilibrium, and other population parameters
were calculated using Genetic Data Analysis Software V1 - d16 (Lewis
and Zaykin 2001).
Results
and Discussion
Ninety-seven
unrelated individuals were genotyped for the loci D7S820, D8S1179,
and D12S391. Alleles already described for these loci were found
in the Rio de Janeiro sample population. In order to confirm the
genotyping, direct sequencing of amplified products was performed
and compared with the standard alleles obtained for K562 cell lineage.
The frequency distributions of the observed alleles are shown in
Table 1. Different numbers of alleles
were found.
- locus D7S820,
8 alleles
- locus D8S1179,
11 alleles
- locus D12S391,
11 alleles
The observed
and expected homozygosities test to evaluate the occurrence of Hardy-Weinberg
expectations, the discrimination power, the fixation index, and
the probability of exclusion are also provided in Table
1. All three loci are highly polymorphic in the Rio de
Janeiro sample population. No detectable departures from Hardy-Weinberg
expectations were observed.
An interclass correlation test analysis was performed to detect
any correlation between alleles at any of the pairwise comparisons
of the three STR loci. The only departure from observed expectations
was for the D8S1179/D12S391 comparison (p=0,0488), whereas the other
two pairwise comparisons showed no detectable deviations: D7S820/D8S1179
(p=0,1160) and D7S820/D12S391 (p=0,4268). However, after the Bonferroni
correction (Weir 1996), this observation is not significant.
Genotype data for this study is available at the following e-mail
address: rsmneto@biologia.ufrj.br
In conclusion, the Rio de Janeiro database has been established
for the loci D7S820, D8S1179, and D12S391. The results of independent
testing support the use of these data for estimating the matching
probability of a DNA profile containing these three STR loci.
References
Carvalho-Silva,
D. R., Santos, F. R., Rocha, J., and Pena, S. D. J. The phylogeography
of Brazilian Y-chromosome lineages, American Journal of Human
Genetics (2001) 68: 281-286.
Costa, A. N.,
Silva, R., and Moura-Neto, R. S. Y-chromosome variation in a Rio
de Janeiro, Brazil, population sample, Forensic Science International
(2002) 126:926-928.
IBGE - Instituto
Brasileiro de Geografia Estatística. Brasil: 500 anos de
povoamento, IBGE, Rio de Janeiro, 2000.
Lewis, P. O.
and Zaykin, D. Genetic data analysis: Computer program for the analysis
of allelic data. Version 1.0 (d16). 2001. Available: http://alleyn.eeb.uconn.edu/gda
Moura-Neto,
R. S. and Budowle, B. Fixed bin population data for the VNTR loci
D1S7, D2S44, D4S139, D5S110, D10S28 and D14S13 in a population sample
from Rio de Janeiro, Brazil, Journal of Forensic Sciences
(1997) 42:926-928.
Miller, S. A.,
Dykes, D. D., and Polesky, H. F. A simple salting-out procedure
for extracting DNA from human nucleated cells, Nucleic Acids
Research (1988) 16:1215.
Silva, R. and
Moura-Neto, R. S. Allelic frequency distribution for three VNTR
markers, D6S132, D7S467, D17S26, in Rio de Janeiro population, Brazil,
Forensic Science International (1998) 94:33-38.
Weir, B. S.
Genetic Data Analysis II. Sinauer Associates, Sunderland,
Massachusetts, 1996.
Top
of the page
|