How to Update GenBank Records

Updating Information on GenBank Records

NCBI

SITE MAP

GenBank
Sequence submission support and software

BankIt
For quick and simple submissions

Sequin
Stand-alone sequence submission tool

SequinMacroSend
Upload .sqn files directly

GenBank often receives updates to submissions in an unusable or incorrect format. The following information provides the different methods to submit updates to GenBank which will ensure that your update is processed quickly and correctly. Updates should be emailed directly to gb-admin@ncbi.nlm.nih.gov, or sent through Bankit Update, or for large .sqn files through SequinMacroSend.

Editing Source Information

Send updates to the source information (i.e. strain, cultivar, country, specimen_voucher) in a two-column tab-delimited table, for example:

acc. num.	strain
AYxxxxxx	82
AYxxxxxy	ABC

Nucleotide Sequence Update

If you are updating the current nucleotide sequence send the complete new sequence(s) in fasta format:

>AYxxxxxx
cggtaataatggaccttggaccccggcaaagcggagagac
>AYxxxxxy
ggaccttgga ccccggcaaagcggagagaccggtaataat

Please do not send a list of nucleotide changes.

Update features on record without annotation

If you are adding annotation to a record that has none, then send us a tab-delimited 5-column table called a Feature table. For example:


>Feature gb|AYxxxxxx|AYxxxxxx
<1	1050	gene
		gene	ATH1
		gene_syn	YPR026W
<1	1009	CDS
		product	acid trehalase
		note	role in sugar metabolism
                        codon_start	2
<1	1050	mRNA
		product	acid trehalase
1626	1590	tRNA
1570	1535
		product	tRNA-Phe
1626	1535	gene
			gene           trnF

Please send your request to gb-admin@ncbi.nlm.nih.gov.

Update features on record with annotation

If you are updating many features of a record, let us know, and we can send you a tab-delimited 5-column Feature table with the current annotation for you to edit and return to us. Please send your request to gb-admin@ncbi.nlm.nih.gov.

Network Aware Sequin

You can use Network aware Sequin to download your existing record from Entrez and make the necessary changes to that file.
Mail the .sqn file containing the updated version to: gb-admin@ncbi.nlm.nih.gov or submit to us via Bankit Update or SequinMacroSend.

Submitting publication and other general information as text

Please send the revised/new information with the relevant GenBank Accession Number(s). You can use Bankit Update or you can include the information in the text portion of an email or as an attached word document and send it to us at gb-admin@ncbi.nlm.nih.gov.

Disclaimer Privacy statement

Revised September 14, 2004