| |
Sequin Help Documentation |
| Sequin | Entrez | BLAST | OMIM | Taxonomy | Structure |
Sequin is a program designed to aid in the submission of sequences to the GenBank, EMBL, and DDBJ sequence databases. It was written at the National Center for Biotechnology Information, part of the National Library of Medicine at the National Institutes of Health. This section of the help document provides a basic overview of how to submit sequences using the Sequin forms. Subsequent sections provide detailed instructions for entering information on each form.
The Sequin help documentation is available in both on-line and World Wide Web (http://www.ncbi.nlm.nih.gov/Sequin/sequin.hlp.html) formats. The text of the on-line version scrolls as you progress through the Sequin forms. Specific words or phrases can be identified with the "find" command at the top of the window. The on-line document can also be saved as a text file, or printed directly to a printer. Click on the window that contains the help documentation. Under the Sequin File menu, choose Export Help... to save the documentation as a text file. To print the documentation without saving it first, click on the help window, and choose Print from the Sequin File menu.
Information is entered into Sequin on a number of different forms. Each form is made up of pages, which are indicated by folder tabs at the top of the form. You can move to the desired page by clicking on the appropriate folder tab. You can also move between pages of a form by clicking on the "Next page" or "Prev page" buttons at the bottom of the screen. You can move to the previous form or the next form by clicking on the "Prev form" or "Next form" buttons on the first or last pages of a form, respectively.
There are two levels of folder tabs. Tabs with large, bold lettering indicate pages that should be filled out for every entry. Tabs with smaller, lighter lettering indicate minor pages that provide access to infrequently used parameters.
There are numerous ways to enter information onto a page of a form. Many of these, such as text fields, radio buttons, check boxes, and scrolling boxes, are standard in other computer programs and will not be described here. Sequin does use two less standard data entry options, pop-up menus and spreadsheets.
Pop-up menus: When the mouse is clicked in one of these menus, a list of choices is displayed. Select the correct option by moving the mouse to that option and letting go. Only one option can be selected.
Spreadsheets: After you input information into a field, another field will appear in which you can enter additional information if necessary.
If you are using Sequin for the first time, you will be prompted to fill out four forms: the Welcome to Sequin form, the Submitting Authors Form, the Sequence Format form, and the Organism and Sequences Form. After you have filled out these forms, a window will appear that contains the Sequin record viewer. This viewer allows you to access many other forms in which you can edit fields filled out in the three initial forms, as well as add additional information you feel should be included in the submission. Detailed instructions on how to fill out the forms and use the record viewer is presented below.
First, indicate with one of the three radio buttons whether you are submitting the sequence to the GenBank, EMBL, or DDBJ database. If you are working on a sequence submission for the first time, click on "Start New Submission". If you are modifying an existing submission record, click on "Read Existing Record". If you would like to quit from Sequin, click on "Quit Program".
You can also "Read Existing Record" to read in a FASTA-formatted sequence file for analysis purposes. The sequence will be displayed in Sequin and can be analyzed with tools such as CDD Search, but it should not be submitted because it does not have the appropriate annotations.
If you are running Sequin in its network-aware mode, you will see another button labeled "Download from Entrez". This option allows you to update an existing database record using Sequin. The record will be downloaded from GenBank into Sequin using the NCBI's Entrez retrieval system. The contents of the record will appear in Sequin, and you can edit them by updating the sequence or the annotations, as necessary. If you do not see the button labeled "Download from Entrez" on the Welcome to Sequin form, you are not running Sequin in its network-aware mode. To make Sequin network-aware, see the instructions later in the help documentation.
You can update only those records that you have submitted, not those submitted by others. To update an existing record, first select which of the databases you will be sending the update to. This should be the database to which the original record was submitted. If you do not know which database to use, send the record to GenBank and the NCBI staff will forward it to the appropriate database. Next, click on the button "Download from Entrez". Enter the Accession number or GI of the sequence on the first form. Then enter "yes" if you are planning to submit the record as an update to one of the databases. Fill out the Submitting Authors form. Instructions for this form are found in the Sequin help documentation under "Edit Submitter Info" under the Sequin File menu. The record will then open in Sequin. Explanations of how to add annotations or update sequences are presented in the documentation entitled "Editing the record" and "Sequence Editor" respectively. You will not see the Submitting Authors Form, the Sequence Format Form, or the Organism and Sequences Form. Note that updates, as well as new records, must be emailed to the appropriate database. Sequin does not support direct submission of records over the Internet.
Additional configuration options are available under the Misc menu. First, you can toggle between the stand-alone and network-aware modes of Sequin. The default mode of Sequin, which is sufficient for most sequence submissions, is stand-alone. In its network-aware mode, Sequin can exchange data with the NCBI and, for example, retrieve sequences from Entrez and perform BLAST searches. The network-aware mode of Sequin is described in detail in the Net Configure section below. Second, if you are running Sequin in its network-aware mode, you can query NCBI's Entrez database. Further information about how to query Entrez is available. Third, you can start the NCBI DeskTop. The DeskTop, which is for advanced Sequin users only, is described below.
Information from this form will be used as a citation for the sequence entry itself. It can contain the same information found in citations associated with the formal publication of the sequence.
On the bottom of each form are two buttons. Click "Prev form" (first page in a form) or "Prev page" (subsequent pages in a form) to go to the previous form or page. Click "Next Form" (last page on a form) or "Next Page" (earlier pages on a form) to move to the next form or page.
Form pages can also be saved individually by using the "Export" function under the File menu. If you are processing multiple submissions, you can use the "Import" function under the File menu to paste previously entered information directly on the page.
The Contact, Authors, and Affiliation pages can be saved as a block so that you can use this information for your next submission. For your first Sequin submission, fill in the requested information on the Submitting Authors form and proceed with the preparation of the submission. In the record viewer, when the submission is basically finished, click on "Edit Submitter Info" under the Edit menu. Under the file menu in the resulting Submission Instructions form, click on Export Submitter Info to save the information to a file. For subsequent Sequin submissions, if you have already saved the submittor information, click on Import Submitter Info under the File menu on the Submission page of the Submitting Authors form. You must still fill in the manuscript title on the Submission page though.
Please select one of the two radio buttons. If you select "Yes", the entry will be released to the public after the database staff has added it to the database. If you select "No", fields will appear in which you can indicate the date on which the sequences should be released to the public. The submission will then be held back by the database staff until formal publication of the sequence or GenBank Accession number, or until the release date, whichever comes first.
Please enter a title that appropriately describes the sequence entry. This is a title for the sequence submission, and you may or may not want it to be the same as the title of an article in which the sequence is described. Later in the submission process, you will have the opportunity to change this information and add references from published or in press works that describe the sequence.
Please enter the name, telephone and fax numbers, and email address of the person who is submitting the sequence. This is the person who will be contacted regarding the sequence submission. This person does not have to be on the list of authors involved in the sequencing. The phone, fax, and email address will not be visible in the database record.
Please enter the names of the people who should receive scientific credit for the generation of sequences in this entry. The person on the Contact page is automatically listed as the first author. This information can be changed if necessary. The author names should be entered in the order first name, middle initial, surname. You can add as many authors to this page as you wish. After you type in the name of the third author, the box becomes a spreadsheet, and you can scroll down to the next line by using the space bar.
Please enter information about the principal institution where the sequencing was performed. This is not necessarily the same as the workplace of the person described on the Contact page. This information will show up in the reference section of the record, with the title Direct Submission.
Use this form to indicate the type, format and category of sequence you are submitting.
Sequin can process single nucleotide sequences as well as sets of related sequences. If the sequences are related in terms of coming from the same publication, or the same organism, they may be candidates for a Batch submission. Biologically related sequences may be classified as environmental samples, population, phylogenetic, mutation, or segmented sets as appropriate. Segmented sets consist of a collection of non-overlapping sequences covering a specific genetic region. In all cases, although the sequences are handled as a single submission, each sequence in a set will receive its own database Accession number and can be annotated independently.
Sequin can display the alignments of sequences that are submitted as part of an aligned phylogenetic, population, mutation set, or environmental samples. Such sequences can be submitted in FASTA, Contiguous (FASTA+GAP, NEXUS, MACAW), or Interleaved (PHYLIP, NEXUS) formats. If the sequences are in FASTA format, Sequin can generate an alignment. If the sequences have already been aligned in FASTA+GAP, PHYLIP, MACAW, or NEXUS, Sequin will not change the alignment. If one of the sequences in your alignment is already present in the GenBank/EMBL/DDBJ database, you must mark that sequence so that it does not receive a new Accession number. Instead of supplying that sequence with a new Sequence Identifier, give it the identifier accU12345, where U12345 is the Accession number of the sequence.
Single sequences, segmented sequences, and batch submissions must be submitted in FASTA format.
Use the radio buttons to indicate which of the following types of submissions you are creating:
Use the radio buttons to select one of the data formats. If you are submitting a single or segmented sequence, or a batch submission, your sequence must be in FASTA format, described below. If you are submitting a set of sequences as part of a population, phylogenetic, or mutation study, you have a choice of sequence formats. You may submit the set as individual sequences in FASTA format. However, if your sequences are already aligned, you can submit the sequences as part of an alignment. Sequin currently accepts the alignment formats FASTA+GAP, PHYLIP, MACAW, NEXUS Interleaved, and NEXUS Contiguous. All formats are described in the Nucleotide Page , below.
Use the radio buttons to indicate whether your sequence corresponds to an original submission or a third-party annotation submission. If you have directly sequenced the nucleotide sequence in your laboratory, your submission would be considered an original submission.
If you have downloaded the sequence from GenBank and added to it your own annotations, your entry may be eligible for submission to the Third-Party Annotation Database (TPA) .
In order to be released into the TPA database, the sequence must appear in a peer-reviewed publication in a biological journal. If you select this option, a pop-up box will appear upon the completion of the Sequence Format form. You must provide some description of the biological experiments used as evidence for the annotation of your TPA submission in this box.
You will be asked later in the submission process to provide the GenBank Accession number(s) of the primary sequence(s) from which your TPA submission was derived.
This form is made up of three pages. On the Organism page, you indicate the organism from which the sequence was derived. However, as explained below, in the case of a set of sequences submitted as part of a phylogenetic study, the organism is indicated either in the sequence file itself or on the following Source Modifiers form. The second page, the Nucleotide page, prompts you to import the nucleotide sequence(s) into Sequin from a separate file. The identity of the third page changes, depending on the submission type indicated on the previous Sequence Format page. If you are submitting a single or segmented sequence, this page is a Protein page, which prompts you to import the relevant amino acid sequence. If you are submitting a population, phylogenetic, or mutation study, this page is an Annotation page, which allows you to add certain annotations to your nucleotide sequence.
Information about the organism from which the sequence was derived should be entered on this page. Alternatively, for any type of submission, the name of the organism, as well as additional information, can be indicated instead in the file that contains the nucleotide sequence. Indeed, if you are submitting a set of sequences for a phylogenetic study, you will not be able to fill out any information on the Organism page. Instead, you must indicate the organism names in the sequence file or on the following Source Modifiers form. A detailed description of how to format this organism information is presented in the documentation for the Nucleotide Page , below.
The scrollable list contains the scientific names of many organisms. To reach a name on the list, type the first few letters of the scientific name into the appropriate field. The list will scroll to the appropriate place, and you can select the organism. When you choose a name from the list, the Scientific Name and the Genetic Code for Translation fields are filled out automatically. If there is a common name for the organism, the Common Name field will be filled out as well. You can also use the space bar to reach the appropriate part of the list. If you have any questions about the scientific or common name of an organism, see the NCBI Taxonomy Browser
If the name of the organism is not on the list, type it in directly. If you do not know the scientific name, please be as specific as you can and include a unique identifier, such as a clone, isolate, strain or voucher number, or cultivar name, e.g.; Nostoc ATCC29106, uncultured spirochete Im403, Lauraceae sp. Vásquez 25230 (MO), Rosa hybrid cultivar 'Kazanlik'. Also, if applicable, indicate if the name is unpublished as of the time of submission. Additional information such as subspecies, strain, isolate, or serotype can be entered later in the submission process.
From the selection list, please enter the location of the genome that contains your sequence. Most entries will have a "Genomic" location. The following is a brief description of the choices in this pop-up menu:
If the submission type was Phylogenetic study, this field will read "Default Genetic Code". Please use this field to select the genetic code that should be used to translate the nucleic acid sequence. The genetic code for a eukaryotic organism is "Standard". If you selected a scientific organism name from the scrollable list described above, this field was filled out automatically. If you encode the organism name directly in the first line of the file that contains your sequence, Sequin will fill out this field automatically after your sequence is imported. However, if the organism is not among the top 500 organisms represented in GenBank, this field will not be filled out automatically, and you must select the genetic code.
For more information regarding the translation tables available, see the NCBI Taxonomy page .
The nucleotide sequence(s) and associated descriptive information are entered on this page. Sequin can also interpret the name of the organism, strain, chromosome, and many other modifiers that are encoded on the first line of the file that contains the nucleotide sequence.
If you are submitting sequences as part of a phylogenetic, mutation, population study, or environmental samples set, you may indicate the organism, strain, chromosome, and other modifiers in one of two places. This information can be encoded in the file that contains the sequence. Alternatively, you can enter the information on the Source Modifiers form which follows the Organism and Sequences Form.
If you are submitting a set of aligned sequences, you can specify sequence characters used in your alignment on this page. Sequin requires that you define any non-IUPAC nucleotide characters in your alignment file. The five types of variable characters are listed under Sequence Characters.
Every sequence within an alignment file must contain the same number of characters (nucleotides + gaps). Gap characters are used to represent the spaces between contiguous nucleotides in an alignment. Gaps that appear at the beginning or end of a sequence are treated differently than gaps that appear between nucleotides and each must be defined. GenBank prefers to use a hyphen (-) to represent gaps. If you use a different character to represent a gap, you will need to add this character to the list in the Beginning Gap, Middle Gap, or End Gap boxes.
Ambiguous characters represent nucleotides that are known to exist, but whose identity has not been experimentally validated. GenBank prefers to use 'n' to represent any ambiguous nucleotides. If you are using a different character to represent an ambiguous base, you will need to add this character to the list in the Ambiguous/Unknown box. Sequin will convert these characters to 'n's when your file is imported.
Match characters denote nucleotides that are identical in every member of an alignment. GenBank prefers the use of a colon (:) to represent match characters. If you are using a different character to represent a match character, you will need to add this character to the list in the Match box.
A database sequence can represent one of several different molecule types. Enter in the Molecule pop-up menu the type of molecule that was sequenced.
Please choose the topology of the molecule, either Linear or Circular, from the pop-up menu. Most sequences have linear topology. Select Circular if the sequence is complete and it has a circular topology, for example, it is a plasmid or a complete mitochondrial genome.
If the sequence is incomplete at the 5' or 3' end, please check the appropriate box. If a complete sequence is entered, for example, the complete coding sequence of a gene, do not check either box.
This box will not be visible if you selected Interleaved or Contiguous format on the Sequence Format form.
We suggest that for standard submissions, you follow the instructions below for how to create a nucleotide sequence in FASTA format. In FASTA format, the line preceding the lines of sequence consists of a ">" sign, followed by some descriptive information. If you follow the instructions, and the line immediately above your sequence reads
>SeqID [org=organism scientific name] title
check this box. The unique sequence identifier for the sequence will be the word that immediately follows the ">".
If you have not included a SeqID, leave this box unchecked, and Sequin itself will assign a unique sequence identifier. However, be sure that the first line of descriptive information starts with a ">".
The sequence(s) that you will be submitting should be located in another file; you cannot directly type sequence data into this page. The sequence(s) must be in a certain format, called the FASTA format. Each line of sequence should be no longer than 80 characters.
Note: If you are submitting multiple sequences as part of a phylogenetic, population, mutation study, or environmental samples set, each sequence must be in FASTA format. However, it does not matter if the sequences are in one file or separate files on your computer. You can encode information about the sequence, such as the organism, chromosome, or strain, in the file that contains the sequence, as described below. Alternatively, this information can be added on the Source Modifiers form which follows the Organism and Sequences Form.
The line directly above the sequence (the first line in the file, for a single sequence) should read
>SeqID [org=organism scientific name] [modifier=modifier name] title
for example,
>DNA.new [org=Homo sapiens] [chromosome=17] [map=17q21] Human breast and
ovarian cancer susceptibility (BRCA1) mRNA, complete cds.
Nucleotide definition lines, or titles, follow a structured format. For an entry that includes a coding region, the definition would be in the format:
Genus species Protein name (gene symbol) mRNA/gene, complete/partial cds
However, the general format does not cover all possible Definition
lines, as shown in the following examples:
>DNA.new [org=Homo sapiens] [chromosome=17] [map=17q21] Homo sapiens breast and ovarian cancer susceptibility protein (BRCA1) mRNA, complete cds.
A number of programs output sets of aligned sequences in FASTA format. Frequently, to align these sequences, gaps must be inserted. Specify relevant gap and ambiguous characters in the appropriate box on the Nucleotide Page form. Each sequence, including gaps, must be the same length. The gaps will only show up in the alignment, not in the individual sequence in the database.
Sequences in FASTA+GAP format resemble FASTA sequences. The previous section on FASTA Format for Nucleotide Sequences has instructions for formatting FASTA sequences. All sequences in FASTA+GAP format should be in the same file.
The following is an example of FASTA+GAP format:
>A-0V-1-A [org=Gallus gallus] [strain=C]
TCACTCTTTGGCAACGACCCGTCGTCATAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
>A-0V-2-A [org=Drosophila melanogaster] [strain=D]
TCACTCTTTGGCAAC---GCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
>A-0V-3-A [org=Caenorhabditis elegans] [strain=E]
TCACTCTTTGGCAAC---GCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
>A-0V-4-A [org=Rattus norvegicus] [strain=F]
TCACTCTTTGGCAACGACCCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
>A-0V-7-A [org=Aspergillus nidulans] [strain=G]
TCACTCTTTGGCAACGACCAGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
A number of programs output sets of aligned sequences in PHYLIP format.
The following is an example of PHYLIP format.
5 100
A-0V-1-A TCACTCTTTG GCAACGACCC GTCGTCATAA TAAAGATAGA GGGGCAACTA
A-0V-2-A TCACTCTTTG GCAAC---GC GTCGTCACAA TAAAGATAGA GGGGCAACTA
A-0V-3-A TCACTCTTTG GCAAC---GC GTCGTCACAA TAAAGATAGA GGGGCAACTA
A-0V-4-A TCACTCTTTG GCAACGACCC GTCGTCACAA TAAAGATAGA GGGGCAACTA
A-0V-7-A TCACTCTTTG GCAACGACCA GTCGTCACAA TAAAGATAGA GGGGCAACTA
AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
In this example, the first line indicates that there are 5 sequences, each with 100 nt of sequence. The following five lines contain the Sequence IDs, followed by the sequences. Specifically, the sequence identifier for the first sequence is A-0V-1-A. Note that subsequent blocks of sequence do not contain the Sequence ID.
Specify relevant gap and ambiguous characters in the appropriate box on the Nucleotide Page form.
You can modify the PHYLIP format so that Sequin can determine the correct organism and any other modifiers for each sequence. An example of such modifications are below in the section on Source Modifiers for PHYLIP and NEXUS .
Alternatively, you can leave your sequence alignment in standard PHYLIP format and enter the organism, strain, chromosome, etc. information on the following Source Modifers form .
A number of programs output sets of aligned sequences in one of two NEXUS formats, NEXUS Interleaved and NEXUS Contiguous.
NEXUS files can contain ? for "missing" at the 5' and 3' ends of sequences, as long as this parameter is properly defined within the header of the NEXUS file.
The following is an example of NEXUS Interleaved format.
#NEXUS
begin data;
dimensions ntax=5 nchar=100;
format datatype=dna missing=? gap=- interleave;
matrix
A-0V-1-A TCACTCTTTG GCAACGACCC GTCGTCATAA TAAAGATAGA GGGGCAACTA
A-0V-2-A TCACTCTTTG GCAAC---GC GTCGTCACAA TAAAGATAGA GGGGCAACTA
A-0V-3-A TCACTCTTTG GCAAC---GC GTCGTCACAA TAAAGATAGA GGGGCAACTA
A-0V-4-A TCACTCTTTG GCAACGACCC GTCGTCACAA T????ATAGA GGGGCAACTA
A-0V-7-A TCACTCTTTG GCAACGACCA GTCGTCACAA TAAAGATAGA GGGGCAACTA
A-0V-1-A AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
A-0V-2-A AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
A-0V-3-A AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
A-0V-4-A AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
A-0V-7-A AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
In this example, the first few lines provide information about the data in the sequence alignment. The following five lines contain the Sequence IDs, followed by the sequences. Specifically, the sequence identifier for the first sequence is A-0V-1-A. Note that subsequent blocks of sequence also contain the Sequence ID. Also, Sequin will replace the "?" characters in the sequences with "N"s since they are defined as "missing" data in the header. You should specify relevant gap and ambiguous characters in the appropriate box on the Nucleotide Page form.
The following is an example of NEXUS Contiguous format.
#NEXUS
BEGIN DATA;
DIMENSIONS NTAX=5 NCHAR=100;
FORMAT MISSING=? GAP=- DATATYPE=DNA ;
MATRIX
A-0V-1-A
TCACTCTTTGGCAACGACCCGTCGTCATAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
A-0V-2-A
TCACTCTTTGGCAAC---GCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
A-0V-3-A
TCACTCTTTGGCAAC---GCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
A-0V-4-A
TCACTCTTTGGCAACGACCCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
A-0V-7-A
TCACTCTTTGGCAACGACCAGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
In this example, the first few lines provide information about the data in the sequence alignment. The following five lines contain the Sequence IDs, followed by the sequences. Specifically, the sequence identifier for the first sequence is A-0V-1-A. Note that subsequent blocks of sequence also contain the Sequence ID.
You can modify either NEXUS format so that Sequin can determine the correct organism and any other modifiers for each sequence. An example of such modifications are below in the section on Source Modifiers for PHYLIP and NEXUS . Alternatively, you can leave your sequence alignment in standard NEXUS format and enter the organism, strain, chromosome, etc. information on the following Source Modifers form .
You can modify the PHYLIP or NEXUS formats so that Sequin can determine the correct organism and any other modifiers for each sequence by adding lines at the end of the file. The first line applies to the first sequence, the second line to the second sequence, and so on. You must have one line for each sequence. These inserted lines resemble the line that immediately precedes the sequence in a FASTA file, except these lines should not begin with a Sequence ID. Instead, the Sequence ID is present at the beginning of the sequence lines as shown above.
Each of the initial lines starts with the character ">". The scientific organism name follows in brackets. Optional modifiers also follow in brackets. You can add individual sequence titles on these lines or you can add the same title to all sequences on the Annotation page. For further information on the data that can go in the lines preceding the sequences, see the instructions entitled "FASTA Format for Nucleotide Sequences", above. For instructions on formatting a sequence title, see Nucleotide Definition Line (Title), above.
The following lines indicating the organims and strain of each sequence
would follow immediately after the sequence in the PHYLIP and NEXUS
examples, above.
>[org=Gallus gallus] [strain=C]
>[org=Drosophila melanogaster] [strain=D]
>[org=Caenorhabditis elegans] [strain=E]
>[org=Rattus norvegicus] [strain=F]
>[org=Aspergillus nidulans] [strain=G]
Alternatively, you can leave your sequence alignment in standard NEXUS or PHYLIP format and enter the organism, strain, chromosome, etc. information on the following Source Modifers form .
Sequin can also read segmented sets that are part of an alignment if the
sequences are in FASTA or FASTA+GAP format. Each segment should have its own
Sequence ID, but organism name
and source modifiers should only be indicated for the first segment from each
sequence. Square brackets are used to delimit the members of a set. For
example,
[
>A-0V-1-Apart1 [org=Gallus gallus] [strain=C]
TCACTCTTTGGCAAC
>A-0V-1-Apart2
GACCCGTCGTCATAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
]
[
>A-0V-2-Apart1 [org=Drosophila melanogaster] [strain=D]
TCACTCTTTGGCAAC
>A-0V-2-Apart2
GAAGCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
]
After your sequence is in the appropriate FASTA or PHYLIP format, click on "Import Nucleotide FASTA" or "Import Nucleotide PHYLIP". A new window will open showing available directories and files. Select the file containing your sequence and click OK. If you have imported the wrong sequence, select Clear under the Edit menu to remove the sequence.
After you import your sequence, a box will appear with information about the sequence. The first line will describe the number of nucleotide segments imported, and the total length in nucleotides of the sequence. Each segment is numbered, and its length, unique identifier (SeqID), and title (Definition line) are listed. If any of this information is missing, check the file containing the sequence and re-import the sequence.
Sets of FASTA-formatted nucleotide sequences can be imported into Sequin in one of two ways. If all the sequences are in the same file, import the file by clicking on "Import Nucleotide FASTA". If the sequences are in separate files, import them sequentially by clicking on "Import Nucleotide FASTA". In either case, the line immediately preceding each sequence must follow the FASTA format described above.
Note: This page is for adding protein sequence to a single or segmented sequence. If you submitted a set of nucleotide sequences from a population, phylogenetic, or mutation study, this page will be instead called Annotation Page and is described below.
This page allows you to provide the protein sequence translated from the nucleotide sequence that you just entered. If the nucleotide sequence is alternatively spliced or contains multiple open reading frames, enter all of the protein sequences on this page. Each protein sequence will appear in the database record as a coding sequence (CDS) feature. Sequin will automatically determine which nucleotide sequences code for the protein and indicate the nucleotide sequence interval on the database record. Sequin also provides tools that allow you to view a graphical representation of all the open reading frames in your nucleotide sequence and to convert these reading frames into CDS features. These tools are described later in the help documentation under the ORF Finder.
Most protein entries are computer-generated conceptual translations of a nucleic acid sequence. If you have confirmed this translation by direct sequencing either of the entire protein or of peptides derived from the protein, please check this box.
If the sequence is lacking amino acids at the amino- or carboxy-terminal end of the protein, please check the appropriate box.
We suggest that for standard simple submissions you follow the instructions below for how to create a protein sequence in FASTA format. In FASTA format, the line preceding the lines of sequence consists of a ">" sign, followed by some descriptive information. If you follow the instructions, and the line immediately above your sequence reads
>SeqID [gene=locus;description] [prot=name;description] title
check this box. The unique sequence identifier for the sequence will be the word following the ">" sign.
If you have not included a SeqID, leave this box unchecked, and Sequin will assign a unique sequence identifier. However, be sure that the first line of descriptive information starts with a ">".
If you check this box, Sequin will make an mRNA feature with the same initial intervals (i.e., range of sequence) as the CDS feature. After the record has been assembled, you should edit the mRNA feature location to add the 5' UTR and 3' UTR intervals. This may be done either in the mRNA editor or in the sequence editor.
This amino acid sequence should be located in a file because you cannot directly type sequence data into this form. It must be in a certain format, called the FASTA format. If you are submitting multiple sequences, each one must be in FASTA format. Each line of sequence should be no longer than 80 characters. Remove any symbols for stop codons, such as "Z" or "*", from your sequence before importing it into Sequin. The line directly above the sequence (the first line in the file, for a single sequence) should read:
>SeqID [gene=locus;description] [prot=name;description] [comment=text] title
for example,
>Prot.new [gene=BRCA1] [prot=Breast and ovarian cancer susceptibility
protein] Homo sapiens breast and ovarian cancer susceptibility protein (BRCA1)
protein, complete sequence.
The protein name should be included in the entry; all other fields are optional.
Protein definition lines, or titles, follow a structured format:
Genus species Protein name (gene name) protein, complete/partial sequence.
Use the name in the format of Genus species. Choose complete or partial, depending whether the sequence is complete or partial.
However, the general format does not cover all possible Definition
lines, as shown in the following examples:
>Prot.new [gene=BRCA1] [prot=Breast and ovarian cancer susceptibility protein] Human breast and ovarian cancer susceptibility protein (BRCA1) protein, complete sequence.
Click on "Import Protein FASTA". A new window will open showing available directories and files. Once a filename is selected, click OK. If you have imported the wrong sequence, select Clear under the Edit menu to remove the sequence.
After you import your sequence, a box will appear with information about the sequence. The first line will describe the number of protein sequences imported and the total length in amino acids of the sequence. Each sequence is numbered, and its length, unique identifier (SeqID), Gene name, Protein name, and title (Definition line) are listed. If any of this information is missing, check the file containing the sequence and re-import the sequence.
You may want to import a non-contiguous set of protein sequences into Sequin if, for example, you are submitting a nucleotide sequence with multiple open reading frames. Sets of protein sequences can be imported into Sequin in one of two ways. If all the sequences are in the same file, import the file by clicking on "Import Protein FASTA". If the sequences are in separate files, import them sequentially by clicking on "Import Protein FASTA". In either case, the line immediately preceding each sequence must follow the FASTA format described above.
After you import protein sequence(s), a new window will appear in which you can edit information about the protein sequence. If you did not enter a unique identifier (SeqID) for the sequence, Sequin generated one automatically. The SeqID and protein name should be filled out, but the protein name can also be modified later in the submission process. Entering other information is optional.
Note: This page is for adding annotations to sets of sequences from phylogenetic, population, mutation, or environmental samples set. If you submitted a single or segmented sequence, this page will be instead called Protein page and is described above.
The radio buttons at the top of the page allow you to choose which feature(s) to add to your sequences. Any annotation you add on this page will be propagated to ALL sequences in the set and will apply over the full length of each sequence. If you want to add annotations only to selected sequences, you must add them manually later in the submission process. You may only select one of these buttons.
This box allows you to add a title to each sequence in the set. Note that the identical title will be added to all sequences. You do not need to add a title here if you already included one in the FASTA format. A detailed description of the title formats preferred by the databases is provided on the Nucleotide page, above.
Titles should always start with the name of the organism. If all the sequences are from the same organism, incorporate the organism name directly into the title. However, if you are submitting sequences that derive from different organisms, for example, a phylogenetic study, do not include the organism names in the title. Instead, check the box marked "Prefix title with organism name", and Sequin will add the appropriate organism name to the title for each sequence.
Sequin will also create titles automatically, using the Generate Definition Line function under the Annotate menu. In addition, titles can be edited later in the submission process by selecting Descriptor-->Title, under the Annotate menu in the record viewer, described below.
You will only see this form if you are submitting sequences as part of a phylogenetic, mutation, population study, environmental samples set, or as a batch submission.
This form allows you to add or modify necessary information, such as the organism, and optional information, such as strain or chromosome, for your sequences. From the top pop-up menu, choose the modifier you want to annotate. The left column lists the sequences by their SeqID, or the unique identifier which you (or Sequin) provided for your sequence. Type the modifier for each sequence in the corresponding box labeled Value. For example, if you select the Organism modifier, you might type Mus musculus in the first Value box, Homo sapiens in the second, etc.
If you have not already supplied the scientific name of the organism, enter it on this form. Do not use abbreviations.
Complete descriptions of these modifiers can be found in the Source and Organism subpages of the Biological Source Modifiers page. You may add as many modifiers as you wish.
You will only see this form if you had previously indicated that the entry is a Third-Party Annotation submission. You must provide the GenBank Accession number(s) of the primary sequence used to assemble your TPA sequence. We can not accept primary sequences corresponding to Reference Sequences or those from proprietary databases. More information about this can be found on the TPA home page.
If a proper GenBank Accession is entered in the first column of the Assembly Tracking form, the GenBank staff can map the coordinates for you. You do not need to fill out the 'from' and 'to' columns. Note that multiple accessions may be entered to provide full coverage of the assembled sequence.
You may also generate an Assembly Tracking form in the Record Viewer under the Annotate menu. Select Descriptors and TPA Assembly from the pull-down menu in order to generate the Assembly Tracking form.
After you finish the Organism and Sequences Form, Sequin will process your entry based on the information you have entered. The window you see now is called the record viewer. This is also the window you will see if you are submitting an update to an existing record. The instructions after this point are the same whether you are submitting a new record or an update.
In the default window of the record viewer, you will see your entry approximately as it would appear in the database. Most of the information that you entered earlier in the submission process is present in the viewer; other information, such as the contact, is still present in the record but will not be visible in the database entry. If you have provided a conceptual translation of the nucleotide sequence, the translation will be listed as a CDS Feature. Sequin automatically determines which nucleotides encode for the protein, and lists them, even if the nucleotide sequence contains introns and exons.
You can save the entry to a file by selecting Save or Save As under the File menu. This is not the same as saving the entry for submission to the database. It is a good idea to save the file at this point so that if you make any unwanted changes during the editing process you can revert to the original copy. If you wish to edit the entry later, click on "Read existing Submission" on the Welcome to Sequin form and choose the file.
It is likely that the entry could be processed now for submission to the database. However, you may wish to add information to the entry. This information may be in the form of Descriptors or Features. In general, Descriptors are annotations that apply to an entire sequence, or an entire set of sequences, and Features are annotations that apply to a specific sequence interval. For example, you may want to change the Reference Descriptor to add a published manuscript, or to annotate the sequence by adding features such as a signal peptide or polyA signal.
Information in the record viewer can be edited in different ways. One way to add or modify information is to double click within the block of information you wish to edit. Many blocks, such as "Definition", "Source", "Reference", or "Features" can be edited. For example, if you wish to add another reference for the sequence, double click on "Reference" to access the appropriate form.
A second way to add or modify information is to create a new descriptor or feature by selecting the appropriate form from the Misc or Features menus. These options are described later in this help document.
Finally, you may need to edit the sequence itself. Instructions for working with the sequence are presented in the documentation for the Sequence Editor.
Once you are satisfied that you have added all the appropriate information, you must process your entry for submission to the database. Select "Validate" under the Search menu. This function detects discrepancies between the format of your submission and that required by the database selected for entry.
If Sequin detects problems with the format of your record, you will see a screen listing the validation errors as well as suggestions for how to fix the discrepancies. Single clicking on an error message scrolls the record viewer to the feature that is causing the error. Double clicking on the error message launches a new form on which you can enter information to correct the problem. If you are annotating a set of multiple sequences, shift-click to scroll to the target sequence and feature. You can also dismiss the suggestion and proceed on your own. When you think you have corrected all the problems, click on "Revalidate".
Message: Select Verbose, Normal, or Terse. Verbose gives a more detailed explanation of the problem.
Filter: Select the error messages you wish to see. You can select ALL, SEQ_INST (errors regarding the sequence itself, its type, or length), SEQ_DESCR (descriptor errors), SEQ_FEAT (feature errors), or errors specific to your record.
Severity: Select the types of error messages you wish to see. You will see the type of message selected, as well as any messages warning of more serious problems.
There are four types of error messages, Info, Warning, Error, and Reject. Info is the least severe, and Reject is the most severe. You may submit the record even if it does contain errors. However, we encourage you to fix as many problems as possible. Note that some messages may be merely suggestions, not discrepancies. A possible Warning message is that a splice site does not match the consensus. This may be a legitimate result, but you may wish to recheck the sequence. A possible Error message is that the conceptual translation of the sequence that you supplied does not encode an open reading frame. In this case, you should check that you translated the sequence in the correct reading frame. A possible Reject message is that you neglected to include the name of the organism from which the sequence was derived. The name of the organism is absolutely required for a database entry.
If Sequin does not detect any problems with the format of your record, you
will see a message that "Validation test succeeded". Click the "Done"
button on the submission viewer, or select "Prepare Submission" under
the File menu. You will be prompted to save the file. Email this file
to the database at the address shown. You MUST email the file; Sequin
does not submit the file automatically over the network. The email
addresses for the databases are:
After your entry is complete, close the record viewer. You will be returned to the Welcome to Sequin form and can begin another entry.
This pop-up menu shows a list of SeqIDs of all nucleotide and protein sequences associated with the Sequin entry. Use the menu to select the sequences displayed in the record viewer, as well as the sequences you want to "target", that is, the sequences you want a descriptor to apply to (see Descriptors in the Sequin help documentation). You may select either an individual sequence by name or a set of sequences, such as All Sequences, or SEG_dna if you have a segmented nucleotide set. You may change the selection at any time.
You may change the display format of the record viewer to any of the formats described below. Editing a field in one display format will change that field in all formats.
This display format shows the entry in a graphical summary format. It is similar to the view shown in the Graphic viewer, except that lines are not labeled. The top bar represents the nucleotide sequence. Lines represent different features on the sequence, such as a CDS (coding sequence) or additional sequences if you have a set of sequences. Double click on an arrow or bar to launch an editing window.
This display format shows the entry in a graphical view. The top bar represents the nucleotide sequence. Lower arrows or bars represent different features on the sequence. Double click on an arrow or bar to launch the appropriate editing window. Any sequence highlighted in the Sequence Editor will be boxed on the graphical view of the sequence. To see a graphical representation of a segmented set (see Submission type , above), the Target Sequence must be set to SEG_dna.
The Style pop-up menu allows you to see the display in different styles and colors.
The Scale pop-up menu allows you to see the display in different sizes. The smaller the number, the larger the display.
This display format shows sets of aligned sequences, such as those imported as part of a population, phylogenetic, mutation, or environmental samples set. When toggled to All Sequences in the Target Sequence pop-up, the alignment of all entries will be displayed. To more closely analyze similarities, you can select a single entry in the Target Sequence pop-up. The complete sequence of the entry selected will be displayed. Any nucleotides in the other sequences that differ from that selected will be displayed, while identical nucleotides will be displayed as a period. You can also display features annotated on the selected target sequence of all sequences using the Feature display toggle. To launch the alignment editor, select Edit Alignment from the Sequin Edit menu.
This display format shows the nucleotide sequence(s) in the record along with any annotated features (such as CDS or mRNA). The display changes depending on what options are selected. Use the Sequences pop-up menu to choose the nucleotide sequences you want to display. If there are multiple sequences in the record, select Aligned to see all sequences. The entire sequence of the "master" sequence will be shown. Other sequences will appear as dots where they are identical to the master, and letters where they are different. If the multiple sequences were imported into Sequin as part of a phylogenetic, population, or mutation study, the "master" sequence can be changed by selecting different sequences in the Target Sequence pop-up. You can use the Features pop-up menu to change the display of the features. You can choose whether you want features displayed for the sequence selected in the Target Sequence pop-up, for all aligned sequences, or for no sequences. With the numbering pop-up menu, select where you want the sequence numbers to be indicated, at the side of the window, at the top of each sequence line, or not at all.
This display format allows you to see the submission as it would appear as a GenBank or DDBJ entry.
This display format allows you to see the submission as it would appear as an EMBL entry.
This display shows the sequence and Definition line only, without any annotations, in a format called the FASTA format. This is a format used by many molecular biology analysis programs. You cannot edit in this display mode.
This display shows the entry in Abstract Syntax Notation 1, a data description language used by the NCBI. You cannot edit in this display mode.
The NCBI DeskTop displays the internal structure of the record being viewed in Sequin. The DeskTop is explained under the Misc menu.
This button allows you to validate the entry when you are finished with the submission. See Submitting the Finished Record to the Database in the Sequin help documentation.
If you have downloaded a sequence from Entrez, you will see additional controls at the bottom of the screen. A sequence downloaded from Entrez will have Entrez neighboring/linking buttons. For example, by selecting the Nucleotide pop-up, you will be able to view nucleotide sequences that are similar to the sequence displayed in the Target Sequence pop-up. Similarly, select MEDLINE to view any literature links.
Descriptors are annotations that apply to an entire sequence, or an entire set of sequences, in a given entry. They do not have a specific location on a sequence, as they apply to the entire sequence. They can be contrasted to Features, which apply to a specific interval of the sequence.
You may edit descriptors in one of two ways.
(1) In the record viewer, double click within the text of the descriptor to bring up a form on which information can be added.
(2) Choose the option Descriptors from the Annotate menu.
This menu allows you either to create new descriptors or to modify existing ones. Select the descriptor that you wish to modify.
When you first select a descriptor, you will see a window called "Descriptor Target Control". Using the target control pop-up menu, select the sequences you wish this descriptor to cover. The name(s) listed correspond to the SeqID(s) given to the nucleotide or amino acid sequences when when they were imported into Sequin. The default selection for this menu is set in the Target Sequence pop-up menu on the record viewer. You may choose to have the descriptor cover just one sequence, or a set of sequences in your entry. If you are creating a new descriptor, select "Create New". If you wish to modify a previous descriptor, select "Edit Old".
The following is a list of some of the descriptors that can be added. Two additional descriptors, those for Publications and Biological Source, are described in other sections.
This is for database staff use only. Please do not modify the date.
This is for database staff use only. Please do not modify the date.
This is for database staff use only.
This descriptor provides general information about the genetic context of the sequence. For example, if your nucleotide sequence is cloned from the region surrounding the Huntington's Disease gene, you could enter that information here. Providing information for this descriptor is optional.
This descriptor is used to list any additional information that you wish to provide about the sequence. Use of this descriptor is optional.
This descriptor contains the information that will go on the Definition line of the database entry. If you supplied a title for your nucleotide sequence when you imported it into Sequin, that information is here. If you wish to change the Definition line, or if you did not supply a title when you submitted the sequence, edit this Descriptor. For more information on creating proper Definition lines, please see the Sequin help documentation for the Organism and Sequences Form.
This descriptor indicates the characteristics of the molecule from which the sequence was derived. The information that you have already entered can be edited here.
A GenBank sequence can represent one of several different molecule types. Enter in the Molecule pop-up menu the type of molecule that was sequenced. A brief description of the choices in this pop-up menu were listed previously.
From the pop-up menu, select the technique that was used to generate the sequence.
From the pop-up menu, select the type of molecule that was sequenced.
From the pop-up menu, select the topology of the sequenced molecule.
From the pop-up menu, select whether the sequence was derived from an organism with a single- or double-stranded genome. This is used primarily for viral submissions.
The Biological Source descriptor is described in more detail below.
Features are annotations which apply to one or more intervals on a sequence. They can be contrasted to Descriptors, that apply to an entire sequences or an entire set of sequences. Features will be added to the Target Sequence selected in the record viewer pop-up menu. Most features are indicated on the nucleotide sequence, even if they refer to amino acid sequence motifs.
You may add or modify features in one of three ways.
(1) In the record viewer, double click on the text of an existing feature to bring up a form on which information can be added.
(2) Choose the feature from the Annotate menu.
(3) Choose the feature from the Sequence Editor Features menu.
The features listed in the Annotate menu and the Sequence Editor Features menu are identical, and the instructions for adding them are the same, with one exception. If you annotate them in the Annotate menu, you must provide the nucleotide sequence location of the feature. However, if you add features from the Sequence Editor, you do not need to know their nucleotide coordinates. Simply highlight the sequence that the feature covers, and the location of the sequence will be automatically entered in the feature location box.
This menu allows you to add or modify features on the sequence selected in the Target Sequence pop-up menu of the record viewer. Features are grouped into six categories. Select the feature that you would like to mark on your sequence. A new form will appear.
Feature forms share a common design. The first page is specific to the particular feature, e.g., Coding Region or Gene. The second page lists Properties of the Feature. The third page describes the Location of the feature. Fill out the appropriate information on the first page.
This page lists the properties of the feature described by the citation.
Enter general comments about the feature here.
Select any of the flags if necessary. If this sequence contains only a partial representation of the feature you are describing, check the "Partial" box. Check the "Exception" box if the feature annotates a post-transcriptional modification of the nucleotide sequence, such as ribosomal slippage or RNA editing. Use the pop-up menu to select what kind of evidence supports existence of the feature. If it was confirmed experimentally, select Experimental. If you have no experimental evidence to support the feature, select Non-Experimental. If you do not wish to select either option, select the blank line.
Most features are associated with a particular gene, normally the gene from which the nucleotide sequence is derived. Select the name of the gene in the pop-up menu. If you want to add the name of a new gene, select new, and enter its name and optional description. By default, mapping between the feature and the gene is done by overlap, that is, the gene associated with the feature is the gene whose location overlaps with the location of the feature. Under some circumstances, for example, if the sequences of two genes overlap, you may wish the feature to apply to a different gene. In this case, select cross-reference, and enter the name of the new gene in the pop-up menu. If you do not want the feature to map to any gene, select suppress. You may also edit information on the Gene feature form by clicking on Edit Gene Feature.
Add any comments about the feature here, especially if you checked the "Exception" box on the General Subpage.
This page is used to list any citations that specifically apply to the feature you are annotating. The citation must have already been entered into the record (see Publications ) in the Sequin help documentation. Click on Edit Citations, and place a check mark in box next to the publication you want to cite. However, we discourage the use of citations on features.
This page is used to cross-reference this entry to entries in external databases (databases other than GenBank, EMBL/EBI, and DDBJ), such as dbEST or FLYBASE. Most users should leave this page blank. For more information on this topic, see the International Nucleotide Sequence Database Collaboration page .
This page allows you to select the location of the feature you are citing. Each feature must have a sequence interval associated with it. In most cases, Sequin will limit the option to the nucleic acid or protein sequence as appropriate.
Check the 5' Partial or 3' Partial box if the feature in your nucleic acid sequence is missing residues at the 5' or 3' ends, respectively. Check the NH2 Partial or COOH Partial if the feature in your amino acid sequence is missing residues at the amino- or carboxy-terminal ends, respectively.
Enter the sequence range of the feature. The numbers should correspond to the nucleotide sequence interval if the SeqID is set to a nucleotide sequence, and to an amino acid sequence interval if the SeqID is set to a protein sequence. If the feature spans multiple, non-continuous intervals on the sequence, indicate the beginning and end points of each interval. If each interval is separate, and should not be joined with the others to describe the feature, check the Intersperse intervals with gaps box (for example, when annotating multiple primer binding sites). If the feature is composed of several intervals that should all be joined together, do not check the box (for example, when annotating mRNA on a genomic DNA sequence).
For nucleic acid Features only: From the pop-up menu, select the strand on which the feature is found.
Use the pop-up menu to select the SeqID of the sequence you are describing by the location.
A brief description of the available features follows. A detailed explanation of how to use the coding region (CDS) feature is included. The DDBJ/EMBL/GenBank feature table definition page provides detailed information about other features.
1) region of DNA at which regulation of termination of transcription occurs, which controls the expression of some bacterial operons; 2) sequence segment located between the promoter and the first structural gene that causes partial termination of transcription.
Constant region of immunoglobulin light and heavy chains, and T-cell receptor alpha, beta, and gamma chains. Includes one or more exons, depending on the particular chain.
CAAT box; part of a conserved sequence located about 75 bp upstream of the start point of eukaryotic transcription units that may be involved in RNA polymerase binding; consensus=GG(C or T)CAATCT.
coding sequence; sequence of nucleotides that corresponds with the sequence of amino acids in a protein (location includes stop codon). Feature includes amino acid conceptual translation.
Most users add a coding region to their sequence when they fill out the Organism and Sequences form. However, you may need to edit the coding region, or add additional ones. Choose CdRgn under the Coding Regions and Transcripts submenu of the Features menu, or to edit an existing CDS, double click on the record viewer. If you appended the partial sequence of a coding region to the Organism and Sequences form, you will probably need to edit the Coding Region feature to avoid validation error messages about the location of the coding region.
Choose the genetic code that should be used to translate the nucleotide sequence. For more information, and for the translation tables themselves, see the NCBI Taxonomy page .
Choose the reading frame in which to translate the sequence.
Supply additional information about the protein by clicking on Edit Protein Information to launch the Protein feature forms. The protein name must have already been filled out on the Protein subpage.
Checking retranslate on accept will, when you click on Accept, translate the nucleotide sequence according to the interval(s) indicated on the Locations page. This new translation will replace any earlier translations you have supplied. This should not be a problem if the interval was indicated appropriately.
If the coding sequence that you supply is a partial sequence and you have checked a Partial box on the Location subpage, it is a good idea to check the Synchronize Partials box. In this case, Sequin will ensure that all other appropriate features (such as protein) are also marked as partial.
Exceptions describe places where there is a posttranslational modification. Enter the amino acid position at which the modification occurs, and select the amino acid that is actually represented in the protein from the pop-up list. Sequin will change the amino acid number to a nucleotide interval. Please provide some explanation for the exception in a comment.
Use this page to enter or edit a name or description of the protein product. For a new sequence, enter information directly into the boxes. You can edit descriptions of an existing sequence by clicking on Edit Protein Information, which will bring up the Protein feature form.
Choose the sequence you want to view by selecting its name under the Product pop-up menu. You may also import a new protein sequence by selecting Import Protein FASTA under the file menu. The sequence should be formatted as described above on the Organism and Sequences form.
After you have imported a protein sequence, click on Predict Interval. This function will predict the interval on the nucleotide sequence to which the coding region applies. If you do not select this function, the interval will likely be wrong, and you will get an error message when you attempt to validate the record. If your sequence is a 5' or 3' partial, you must first indicate this manually on the Location Page.
You may also have Sequin generate the protein sequence from the nucleotide sequence by clicking on Translate Product. However, unless the location of the coding region is correctly indicated on the Location page, Sequin will translate the entire nucleotide sequence, including potential 5' and 3' untranslated regions. This will likely result in error messages when you attempt to validate the record. You must also select the correct reading frame on the General subpage.
Independent determinations of the "same" sequence differ at this site or region.
Displacement loop; a region within mitochondrial DNA in which a short stretch of RNA is paired with one strand of DNA, displacing the original partner DNA strand in this region; also used to describe the displacement of a region of one strand of duplex DNA by a single stranded invader in the reaction catalyzed by RecA protein.
Diversity segment of immunoglobulin heavy chain, and T-cell receptor beta chain.
A cis-acting sequence that increases the utilization of (some) eukaryotic promoters and can function in either orientation and in any location (upstream or downstream) relative to the promoter.
Region of genome that codes for portion of spliced mRNA; may contain 5' UTR, all CDSs, and 3' UTR.
Gap in the sequence, only applied to gaps of unknown length. The location span of the gap feature is 100 base pairs, indicated by 100 "n"s in the sequence. The qualifier /estimated_length=unknown is mandatory.
GC box; a conserved GC-rich region located upstream of the start point of eukaryotic transcription units that may occur in multiple copies or in either orientation; consensus=GGGCGG.
Region of biological interest identified as a gene and for which a name has been assigned.
Intervening DNA; DNA which is eliminated through any of several kinds of recombination.
A segment of DNA that is transcribed, but removed from within the transcript, by splicing together the sequences (exons) on either side of it.
Joining segment of immunoglobulin light and heavy chains, and T-cell receptor alpha, beta, and gamma chains.
Long terminal repeat, a sequence directly repeated at both ends of a defined sequence, of the sort typically found in retroviruses.
Mature peptide or protein coding sequence; coding sequence for the mature or final peptide or protein product following post-translational modification. The location does not include the stop codon (unlike the corresponding CDS).
Site in nucleic acid that covalently or non-covalently binds another moiety that cannot be described by any other Binding key (primer_bind or protein_bind).
Feature sequence is different from that presented in the entry and cannot be described by any other Difference key (conflict, unsure, old_sequence, mutation, variation, allele, or modified_base).
Region of biological interest which cannot be described by any other feature key.
Site of any generalized, site-specific, or replicative recombination event where there is a breakage and reunion of duplex DNA that cannot be described by other recombination keys (iDNA and virion) or qualifiers of source key (/insertion_seq, /transposon, /proviral).
Any transcript or RNA product that cannot be defined by other RNA keys (prim_transcript, precursor_RNA, mRNA, 5'clip, 3'clip, 5'UTR, 3'UTR, exon, intron, polyA_site, rRNA, tRNA, scRNA, snoRNA, and snRNA).
Any region containing a signal controlling or altering gene function or expression that cannot be described by other Signal keys (promoter, CAAT_signal, TATA_signal, -35_signal, -10_signal, GC_signal, RBS, polyA_signal, enhancer, attenuator, terminator, and rep_origin).
Any secondary or tertiary structure or conformation that cannot be described by other Structure keys (stem_loop and D-loop).
The indicated nucleotide is a modified nucleotide and should be substituted for by the indicated molecule (given in the mod_base qualifier value).
messenger RNA; includes 5' untranslated region (5' UTR), coding sequences (CDS, exon) and 3' untranslated region (3' UTR).
Extra nucleotides inserted between rearranged immunoglobulin segments.
The presented sequence revises a previous version of the sequence at this location.
Region containing polycistronic transcript under the control of the same regulatory sequences.
Recognition region necessary for endonuclease cleavage of an RNA transcript that is followed by polyadenylation; consensus=AATAAA.
Site on an RNA transcript to which will be added adenine residues by post-transcriptional polyadenylation.
Any RNA species that is not yet the mature RNA product; may include 5' clipped region (5' clip), 5' untranslated region (5' UTR), coding sequences (CDS, exon), intervening sequences (intron), 3' untranslated region (3' UTR), and 3' clipped region (3' clip).
Primary (initial, unprocessed) transcript; includes 5' clipped region (5' clip), 5' untranslated region (5' UTR), coding sequences (CDS, exon), intervening sequences (intron), 3' untranslated region (3' UTR), and 3' clipped region (3' clip).
Non-covalent primer binding site for initiation of replication, transcription, or reverse transcription. Includes site(s) for synthetic e.g., PCR primer elements.
Region on a DNA molecule involved in RNA polymerase binding to initiate transcription.
Non-covalent protein binding site on nucleic acid.
Ribosome binding site.
Region of genome containing repeating units.
Single repeat element.
Origin of replication; starting site for duplication of nucleic acid to give two identical copies.
Mature ribosomal RNA ; the RNA component of the ribonucleoprotein particle (ribosome) that assembles amino acids into proteins.
Switch region of immunoglobulin heavy chains. Involved in the rearrangement of heavy chain DNA leading to the expression of a different immunoglobulin class from the same B-cell.
Many tandem repeats (identical or related) of a short basic repeating unit; many have a base composition or other property different from the genome average that allows them to be separated from the bulk (main band) genomic DNA.
Small cytoplasmic RNA; any one of several small cytoplasmic RNA molecules present in the cytoplasm and (sometimes) nucleus of a eukaryote.
Signal peptide coding sequence; coding sequence for an N-terminal domain of a secreted protein; this domain is involved in attaching nascent polypeptide to the membrane; leader sequence.
Small nuclear RNA involved in pre-mRNA splicing and processing.
Small nucleolar RNA molecules generally involved in rRNA modification and processing.
Identifies the biological source of the specified span of the sequence. This key is mandatory. Every entry will have, as a minimum, a single source key spanning the entire sequence. More than one source key per sequence is permittable.
Hairpin; a double-helical region formed by base-pairing between adjacent (inverted) complementary sequences in a single strand of RNA or DNA.
Sequence Tagged Site. Short, single-copy DNA sequence that characterizes a mapping landmark on the genome and can be detected by PCR. A region of the genome can be mapped by determining the order of a series of STSs.
TATA box; Goldberg-Hogness box; a conserved AT-rich septamer found about 25 bp before the start point of each eukaryotic RNA polymerase II transcript unit that may be involved in positioning the enzyme for correct initiation; consensus=TATA(A or T)A(A or T).
Sequence of DNA located either at the end of the transcript or adjacent to a promoter region that causes RNA polymerase to terminate transcription; may also be site of binding of repressor protein.
Transit peptide coding sequence; coding sequence for an N-terminal domain of a nuclear-encoded organellar protein; this domain is involved in post- translational import of the protein into the organelle.
Mature transfer RNA, a small RNA molecule (75-85 bases long) that mediates the translation of a nucleic acid sequence into an amino acid sequence.
Author is unsure of exact sequence in this region.
Variable region of immunoglobulin light and heavy chains, and T-cell receptor alpha, beta, and gamma chains. Codes for the variable amino terminal portion. Can be made up from V_segments, D_segments, N_regions, and J_segments.
Variable segment of immunoglobulin light and heavy chains, and T-cell receptor alpha, beta, and gamma chains. Codes for most of the variable region (V_region) and the last few amino acids of the leader peptide.
A related strain contains stable mutations from the same gene (e.g., RFLPs, polymorphisms, etc.) that differ from the presented sequence at this location (and possibly others).
3'-most region of a precursor transcript that is clipped off during processing.
Region near or at the 3' end of a mature transcript (usually following the stop codon) that is not translated into a protein; trailer.
5'-most region of a precursor transcript that is clipped off during processing.
Region near or at the 5' end of a mature transcript (usually preceding the initiation codon) that is not translated into a protein; leader.
Pribnow box; a conserved region about 10 bp upstream of the start point of bacterial transcription units that may be involved in binding RNA polymerase; consensus=TAtAaT.
A conserved hexamer about 35 bp upstream of the start point of bacterial transcription units; consensus = TTGACa or TGTTGACA.
This annotation is very important, as an entry cannot be processed by the databases unless it includes some basic information about the organism from which the sequence was derived. This basic information was entered previously in the submission, in the Organism and Sequences Form. The more detailed Organism Information form allows you to alter or add to the data you entered earlier.
Sequin allows two types of biological source information to be entered, Biological Source Descriptors and Biological Source Features. Biological Source Descriptors, like other descriptors, provide organism information about an entire sequence, or an entire set of sequences, in an entry. Biological Source Features, like other features, provide organism information about a specific interval on a given sequence.
In most cases, you will want to use a Biological Source Descriptor, because all the sequences in the entry will derive from the same source. However, if you have sequenced a chimeric molecule, for example, one that is part yeast and part mouse, you would use Biological Source Features to annotate which sequence was derived from yeast and which from mouse.
To add a Biological Source Descriptor, select Biological Source under the Descriptor section of the Annotate menu. To add a Biological Source Feature, select Biological Source under the Bibliographic and Comments section of the Annotate menu.
Annotating a Biological Source Descriptor or Feature is similar to annotating any descriptor or feature. For help in creating descriptors and features, see the appropriate section of the help documentation. The following are instructions for filling out Biological Source-specific forms.
The scrollable list contains the scientific names of many organisms. To reach a name on the list, either type the first few letters of the scientific name, or use the thumb bar. Click on a name from the list to fill out the scientific name field. If there is a common name for the organism, that field will be filled out automatically. You may also directly type in the scientific name. If you have any questions about the scientific or common name of an organism, see the NCBI taxonomy browser
From the selection list, please enter the location of the genome that contains your sequence. Most entries will have a "Genomic" location. A brief description of the choices in this pop-up menu were listed previously.
This menu is for the use of database personnel. Please leave this field empty.
Please use this field to select the genetic code that should be used to translate the nucleic acid sequence. The genetic code for a eukaryotic organism is "Standard". If you selected an organism name from the scrollable list described above, this field was filled out automatically.
For more information regarding the translation tables available, see the NCBI Taxonomy page .
This information is normally entered by the database staff. They will use the Taxonomy database maintained by the NCBI/GenBank.
If you disagree with the lineage supplied please notify the database staff.
If you are running Sequin in its network-aware mode, you will see a button labeled "Lookup Taxonomy". Click on this button to perform an automatic look-up of the taxonomic lineage of the organism. Sequin will perform the look-up by accessing the Taxonomy database and will fill out the Taxonomic Lineage and Division fields.
If you have any comments about the taxonomic lineage determined by Sequin, please submit these comments with your entry. Under the Sequin File menu, select Edit Submitter Info. Enter your comments in the box entitled "Special Instructions to Database Staff", on the Submission page. Someone from the NCBI will contact you after your submission is received.
This page allows you to enter additional information about the source and/or organism. Entering information is optional.
Choose a modifier from the pull-down menu on the left side of the page and type the appropriate name on the right side of the page. If you do not find appropriate modifiers in the scroll down list, you can enter additional source information as text in the field at the bottom of the page. You may select as many modifiers as you want.
The following is a description of the available modifiers:
Choose a modifier from the pull-down menu on the left side of the page and type the appropriate name on the right side of the page. If you do not find appropriate modifiers in the scroll down list, you can enter additional organism information as text in the field at the bottom of the page. You may select as many modifiers as you want.
The following is a description of the available modifiers:
Please do not use this form. This field is reserved for information from NCBI's taxonomy database.
If there are alternative names for the organism from which the sequence was derived, enter them here. Please be aware that this is the appropriate field only for alternative names for the organism, not for alternative gene or protein names.
This page is used to cross-reference this entry to entries in external databases (databases other than GenBank, EMBL/EBI, and DDBJ), such as dbEST or FLYBASE. Most users should leave this page blank. For more information on this topic, see the International Nucleotide Sequence Database Collaboration page .
Sequin allows two types of publications to be entered, Publication Descriptors and Publication Features. Publication Descriptors are bibliographic references that, like other descriptors, cover an entire sequence, or an entire set of sequences, in an entry. Publication Features are bibliographic references that, like other features, cover a specific interval on a given sequence.
Publications are entered into the Reference field of the database entry. References are citations of unpublished, in press, or published works that are relevant to the submitted sequence. Publications should provide information regarding the principle cloning and determination of the sequence within the record.
In general, there is one publication describing a sequence, and a Publication Descriptor should be used. To enter a Publication Descriptor, select Publications under the Annotate menu and click on Publication Descriptor.
However, if one publication describes the cloning of the 5' end of a gene, and another publication describes the cloning of the 3' end of the gene, Publication features may be used. To make a publication feature, choose Publication Feature in the Publications section of the Annotate menu. Enter the information about the publication, and then enter the nucleotide interval to which the publication refers on the Location page.
Using the radio buttons, select one of the three options:
Using the radio buttons, select the type of publication in which the sequence will appear.
After you have filled out the Citation on Entry form, click on "Proceed" to see the next form.
Please enter the names of the authors. Note that the first name of the author is listed first. You can add as many authors to this page as necessary. After you type in the name of the third author, the box becomes a spreadsheet, and you can scroll down to the next line by using the thumb bar. The suffix toggle allows the addition of common suffixes to the author name. The consortium field should be used when a consortium is responsible for the sequencing or publication of the data. Individual authors may be listed along with a consortium name.
Please enter information about the institution where the sequencing was performed.
Other pages in the Citation Information Form will be different, depending on the Class of publication selected in the Citation on Entry Form. Instructions for filling out the Citation Information Form for Journals is included here.
Enter title for manuscript in the box.
Fill in the appropriate Journal, Volume, Issue, Pages, Day, and Year fields by typing information into the boxes. Select the month with the pop-up menu. If necessary, choose an option from the Erratum pop-up menu and explain the erratum.
If you are running Sequin in its network-aware mode, the program will look up the Title, Author, and Journal information in the MEDLINE database if you supply it with some minimal information. For example, if you know the MUID (MEDLINE Unique Identifier) of the publication, enter it in the appropriate box and select "Lookup By MUID." Sequin will automatically retrieve the rest of the information. One way to find the MUID of the publication is to look up the publication with the NCBI's Entrez service. Alternatively, if you do not know the MUID, enter the Journal, Volume, Pages, and Year. Then select "Lookup Article". Sequin will retrieve the missing Title and Author information.
This page is reserved for use by the database staff.
Details about the current version of Sequin.
Launches the help documentation.
Open an existing entry. This option will open a record that has been previously saved in Sequin. Furthermore, for analysis purposes, it can also open a FASTA-formatted sequence file. The sequence will be displayed in Sequin and can be analyzed with tools such as CDD Search, but it should not be submitted, because it does not have the appropriate annotations.
Opens a FASTA formatted sequence directly into the Sequence Editor. The sequence can then be analyzed with tools such as the "Find" command.
Close this entry.
Exports the GenBank flatfile format to a file.
Duplicates the entry. You can then view the entry simultaneously in different Display Formats.
Saves the entry. Note: This merely saves the entry so you can go back and edit it. It does not prepare the entry for submission to the database, that is, it does not validate the entry.
See Save.
Replaces the displayed record with a previously saved version. This feature is useful if you have made unwanted changes since you last saved the record.
Prepares the entry for submission to the database. See Submitting the Finished Record to the Database in the Sequin help documentation.
Prints the window that is currently selected. The selected window can be one of the Sequin forms or pages, or the help documentation.
Exit from Sequin.
Copy the selected item.
Clear the selected item.
Duplicates the selected feature.
To edit a single sequence, select the sequence identifier in the Target Sequence pop-up menu, and click on Edit sequence. The sequence editor will be launched for that sequence. The sequence editor is discussed in more detail below.
To edit a set of aligned sequences, select All Sequences in the Target Sequence pop-up menu and select Alignment in the Display Format. Highlight the alignment by clicking inside of the box surrounding the sequence bars, and click on Edit alignment. The alignment editor will be launched. The alignment editor is discussed in more detail below.
Opens up the Submission Instructions form, which allows you to enter additional information about the person submitting the record. Much of this information was entered on the first form in Sequin, the Submitting Authors form.
You can also save the information from the Submitting Authors form here, so that you can use it in subsequent Sequin submissions. Click on "Edit Submitter Info" and, under the file menu in the resulting Submission Instructions form, click on Export Submitter Info to save the information to a file. For subsequent Sequin submissions, if you have already saved the submittor information, click on Import Submitter Info under the File menu on the Submission page of the Submitting Authors form.
Indicate the type of submission. If it is a new submission, select New. If you are updating an existing submission in order to resubmit it to the databases, select Update. Check either the "Yes" or "No" radio button to indicate if the record should be released before publication. If you select "Yes", the entry will be released to the public after the database staff has added it to the database. If you select "No", fields will appear in which you can indicate the date on which the sequences should be released to the public. The submission will then be held back by the database staff until formal publication of the sequence or GenBank Accession number, or until the Release Date, whichever comes first. If you have any special instructions, enter them in the box at the bottom of the page.
Update the name, affiliation, or contact numbers of the person submitting the record.
Update the names and affiliation of the people who should receive scientific credit for the generation of sequences in this entry. The address should list the principal institution in which the sequencing and/or analysis was carried out. If multiple labs were involved in the project, this page should contain information about the workplace of the senior author. If you are submitting the record as an update to the databases, explain the reason for the update on the Description subpage.
This selection allows you to replace a sequence with another sequence, merge two sequences that overlap at their ends, 'patch' a corrected fragment of a sequence to the current sequence, or copy features from one sequence to another.
Use Read FASTA file to import a sequence in FASTA format. Use Read Sequence Record to import a sequence in ASN.1 format (for example, a sequence record that has already been saved in Sequin). If you are running Sequin in Network Aware mode, you can use Download Accession to import a record from Entrez. If you have done a QBLAST search, you can use Selected Alignment to import a sequence from the alignment that you have selected in the Graphic or Alignment view.
In all cases, the imported and original sequences must have regions similar enough for the two sequences to be aligned. If the sequences are not similar enough to generate an alignment, Sequin will inform you that the similarity is insufficient to perform the update.
After you import the updated sequence, a new window will open that displays two graphical views and the text of the alignment of the new and old sequence. The first graphic displays the relative length of the two sequences and the length of the overlapping region between sequences. The second graphic represents any inserts, deletions, or point changes within the aligned region between the new and old sequences. Clicking on a region in this graphic will scroll to the corresponding nucleotide sequence in the alignment text below.
The alignment relationship box shows the action that will be performed upon updating the sequence, i.e., replace, extend 5', extend 3', or patch. The patch function allows you to replace an internal fragment of the sequence without affecting flanking regions.
When updating via the Download Accession or Read Sequence Record methods, the update operation box allows you to specify whether the sequence and/or the features should be updated. In cases where the new and old records contain duplicate features, you may chose to retain the new and/or old feature or merge the duplicated features into one.
The check boxes at the bottom of the form allow you to specify actions to be taken regarding coding regions and references when updating the sequence. Add Cit-subs for Updated Sequences is used by the database staff to append reference information regarding the updating of publicly available sequences. Please do not use this function. By default, Update Proteins for Updated Sequences is selected. Sequin will attempt to clean-up conceptual translations of annotated coding regions based on the updated nucleotide sequence. You can also select options which will truncate retranslated proteins at stops, extend retranslated proteins without stops or extend retranslated proteins without starts. The Correct CDS genes function adjusts the corresponding gene span based on the new coding region span. In any case, all annotated coding regions should be manually reviewed following a sequence update.
This selection functions similar to the Update Sequence function. However, you can extend the existing sequence in either the 5' or 3' direction in cases where there is no overlap between the existing and new sequences.
This selection allows you to propagate any annotated feature from one sequence in an aligned set to other sequences within the set. For example, if one nucleotide sequence in the alignment contains a CDS feature, you can annotate a similar CDS, over the same interval, to the other nucleotide sequences in the set.
The default source of features to be propagated is the first member of the set. If you would like to use a different entry as the source of the features, scope to that entry in the Target Sequence menu before selecting Feature Propagate from the Edit menu.
The Feature Propagate window allows you to select which features will be propagated and whether the features will be extended or split at gaps in the alignment. The split at gaps selection will produce two features, one on either side of the gap within the alignment. If you are propagating a CDS feature, you may specify that the translation end or extend through internal stop codons. You may also extend the translation after the stop codon on the source entry by chosing to translate the CDS after partial 3' boundary. If the CDS that you are propagating to other records is partial on either end, you should select the 'Cleanup CDS partials after propagation' check box. This will retain the partial nature of the CDS features on all records. The fuse adjacent propagated intervals function will create one feature from two of the same type that contain abutting nucleotide intervals due to the nature of the alignment used for propagation.
This selection allows you to add a new sequence to an existing population, mutation, phylogenetic, or environmental sample set. You may import the new entry in FASTA format or ASN.1 format (for example, a sequence record that has been saved in Sequin).
Under this command, you can find and replace strings of letters in those fields of your submission that contain manually entered data. The fields that can be altered are Locus, Definition, Accession, Keywords, Source, Reference, and Features. To use this option, select Find and fill the Find and Replace lines with the appropriate text. Note that you cannot edit the sequence in this way.
Under this command, you can find strings of letters in all fields of your submission. You can use the Find First and Find Next buttons to identify the specified text sequentially through the flatfile.
This option allows you to move quickly in the Record Viewer to a gene feature containing the specified gene symbol.
This option allows you to move quickly in the Record Viewer to a CDS feature containing the specified product name.
This option allows you to move quickly in the Record Viewer to any feature annotated at the specified nucleotide location.
This option detects discrepancies between the format of your submission and that required by the database selected for entry. If discrepancies are present, it suggests ways in which to correct them. See the topic on Submitting the Finished Record to the Database in the Sequin help documentation.
Performs a spelling check on the record versus the PubMed database.
Performs a CDD BLAST search of the selected sequence against the NCBI's Conserved Domain Database . To do a CDD BLAST search, Sequin must be in its network aware mode.
CDD currently contains domains derived from two popular collections, Smart and Pfam, plus contributions from colleagues at NCBI. The source databases also provide descriptions and links to citations. Since conserved domains correspond to compact structural units, CDs contain links to 3D-structure via Cn3D whenever possible.
The results of the CDD search will be displayed in the record viewer. These results are for your use only and should be removed from the record before submission.
The ORF Finder shows a graphical representation of all the open reading frames (ORFs) in the nucleotide sequence. This tool allows you to select ORFs and have them appear as coding sequence (CDS) features on the sequence record.
The ORFs, indicated by colored boxes, are defined as the longest sequence containing a start codon and a stop codon. If the entire nucleotide sequence is an open reading frame but does not contain an initial start or a terminal stop codon, it will be indicated as an ORF as well. All six reading frames are shown; the top three boxes represent the plus strands, and the bottom three boxes the minus strands. The nucleotide sequence intervals of the ORFs are displayed in descending length order on the right side of the window. Intervals on the complementary (minus) strand are indicated by a 'c'. ORFs can be selected by clicking either directly on them or on the sequence interval. The ORF length button selects the length of ORFs that are displayed. For example, the default of 10 shows all ORFs that are greater than 10 nucleotides in length. Clicking on the box labelled ORF changes the display; potential start codons are indicated in white, and stop codons in red. ORFs can be selected in this display also. The definition of start and stop codons is dependent on the genetic code that was selected. Be sure to choose the appropriate genetic code from translating the sequence before opening the ORF finder.
The ORF finder works in conjunction with the Sequence Editor. Once an ORF is selected, its sequence is highlighted in the editor. Using tools in the Sequence Editor, you can make the highlighted sequence into a CDS, translate it, and save it as a CDS feature in the record. See the documentation on Editing a CDS in the Sequence editor .
This option changes the sequence that is selected in the Target Sequence pop-up. Type the SeqID of the sequence in the box, and the record viewer will be updated to display that sequence.
The Style manager allows you to choose between different formats in which to view the Graphical Display Format. The graphical display is selected by choosing the Graphic display format on the record viewer. Using the Style Manager, you can also copy the style or modify it to suit your needs.
As a default, Sequin is available as a stand-alone program. However, the program can also be configured to exchange information with the NCBI (GenBank) over the Internet. The network-aware mode of Sequin is identical to the stand-alone mode, but it contains some additional useful options.
Sequin will only function in its network-aware mode if the computer on which it resides has a direct Internet connection. Electronic mail access to the Internet is insufficient. In general, if you can install and use a WWW browser on your system, you should be able to install and use network-aware Sequin. Check with your system administrator or Internet provider if you are uncertain as to whether you have direct Internet connectivity.
There are two ways to change Sequin into its network-aware mode. If you are still on the initial Welcome to Sequin form, select Net Configure under the Misc menu. If you have already worked on a Sequin submission and are looking at the record in the record viewer, select the Net Configure option from the Misc menu.
Most users will be able to use the default (Normal) settings on the Network Configuration page; select Accept to complete the configuration process.
If a "Normal" Connection does not work, you may need to select the Firewall Connection. Contact your system administrator to determine what to enter into the Proxy and Port fields. If you do not have access to the domain name server (DNS), uncheck this box.
The Timeout pop-up selects the length of time that your local copy of Sequin will wait for a reply from the NCBI server. You may need to set this number higher (i.e., 60 seconds or 5 minutes) if you are outside of the United States or have a bad internet connection.
If you have problems setting up the network configuration, contact info@ncbi.nlm.nih.gov.
If you would like to change Sequin back to its stand-alone mode, select Net Configure again from the Misc menu. Click on Connection: None.
The network-aware mode of Sequin allows you to perform a number of additional, important functions. These functions all appear as additional menu items. A brief description of these functions follows. Further descriptions are available as indicated elsewhere in the help documentation.
Using Sequin in its network-aware mode, you can download an existing GenBank record from Entrez using the GenBank accession number or GI identification number (NID). You can then use Sequin to make any necessary changes to the record, and resubmit it to GenBank as a sequence update. Instructions for submitting sequence updates are presented under the Welcome to Sequin Form. You can download any record from Entrez and look at it in Sequin. However, you can only formally update those records which you have submitted since submitters retain editorial control of their records.
In its network-aware mode, Sequin can import the relevant sections of a MEDLINE record directly into a sequence submission record. Rather than typing in the entire citation, you can enter minimal information, such as the MEDLINE Unique Identifier (MUID), or Journal name, volume, year, and pages. The MEDLINE lookup is explained in the section of the documentation entitled Publications.
In its network-aware mode, Sequin can look up the taxonomic lineage of an organism from the NCBI's Taxonomy database. This look-up is normally performed by the NCBI database staff after the record has been submitted to GenBank. If you look up the taxonomy before submitting the sequence, you can make a note in the record of any disagreements. The taxonomy lookup is explained in the section of the documentation covering Biological Source: Organism page: Lineage subpage.
The NCBI DeskTop displays the internal structure of the record being viewed in Sequin. The DeskTop is explained under the Misc menu.
This option allows you to perform a query against the NCBI's Entrez database.
If you have downloaded a sequence from Entrez, it will have the Entrez neighbor buttons at the bottom of the window. To see similar nucleotide sequences, select Nucleotide in the Target pop-up menu, and then click on the Neighbor button to the left to get the Entrez list of related sequences. To see the Entrez records for any publications or CDSs in the record, select the MEDLINE or Protein database, and click on the Lookup button. Any associated Genome or Structure records can also be viewed.
This option is only available if you are running Sequin in its network-aware mode.
The NCBI DeskTop provides a view of the internal structure of the Sequin record, the ASN.1. Its display resembles a Venn diagram and represents all the structures represented in the ASN.1 data model.
In addition, a number of undocumented software tools from the NCBI can be accessed from the DeskTop. These tools are components of the NCBI portable software Toolkit. You can also customize these functions using the Toolkit with your own software tools. The Toolkit and its documentation are available from the NCBI by anonymous FTP.
The DeskTop should only be used by very seasoned users. At this time, we are not providing any documentation for these specialized functions.
This menu allows you to enter features and descriptors on the sequence.
The first six options, Genes and Named Regions, Coding Regions and Transcripts, Structural RNAs, Bibliographic and Comments, Sites and Bonds, and Remaining Features refer to types of Features that can be added to the sequence. Features are described in more detail in the above section entitled Features.
If you are submitting a set of similar sequences, you can add the same feature across the entire span of each by using the Batch Feature Apply option. The feature must span the entire nucleotide sequence of each member; you can not annotate specific nucleotide locations using this option (for this, see Feature Propagate). For each feature, you will be prompted to designate whether the feature is 5' or 3' partial and whether is is on the plus or minus strand. You may also add a comment of other qualifier to the feature. The Add Qualifier option allows you to add a qualifier to an existing feature. You must specify the feature and qualifier in the Add Qualifier pop-up box. Source qualifiers can be added to all entries using the Add Source Qualifier option. Qualifiers specific to the CDS and gene can be added using Add CDS-Gene-Prot and RNA qualifiers using Add RNA Qual. In each case, a pop-up box appears with qualifier options appropriate for that feature.
The Batch Feature Edit function allows you to edit existing qualifiers. For each menu choice, a pop-up box allows you to select the feature containing the qualifier and the specific qualifier to be edited. You can use the Find/Replace text boxes to edit the information contained within the qualifier.
The Publications option allows you to add a Publication Feature or Publication Descriptor to the record. Publications are described in more detail in the above section entitled Publications.
The Descriptors option allows you to add Descriptors to the record. Descriptors are described in more detail in the section entitled Descriptors, above.
The Generate Definition Line option will generate a title for your sequence based on the information provided in the record. This option will work for single sequences as well as sets of sequences, and can handle complex annotations with multiple features. The title will follow GenBank conventions, but may be modified by the database staff if it is not appropriate. The title you enter here will replace any title you entered elsewhere in the submission, for example, any title that was attached to the nucleotide sequence. For a description of definition lines, see Nucleotide Definition Line (Title) , above.
Use this item to change the display font. From the pop-up menus, choose the style and size of type. For additional changes, mark the Bold, Italic, or Underline check boxes. The default font is 10-point Courier.
Enabled only in the Graphic view, it shows what the various kinds of features used in the picture look like, i.e., what colors and styles and fonts each one uses.
This editor allows you to modify the nucleotide or amino acid sequences in your entry. For example, you can add or remove nucleotides, or you can add or remove CDS (coding sequence) features from the entry.
Although the Sequence Editor does allow you to undo changes you make to the sequence, we strongly suggest that you save a copy of the entry before launching the Sequence Editor so that you can revert to it if necessary.
The sequence that appears in the editor is dependent on the sequence(s) selected in the Target Sequence pop-up menu. There are two ways to launch the sequence editor for nucleotide sequences. First, you can double click within sequence in any display format of the record viewer. A window containing the DNA sequence will appear. Second, in the record viewer, select the sequence that you would like to edit in the Target Sequence pop-up menu. Click on Edit Sequence under the Edit menu. You can launch the editor for protein sequences in two ways also. If you select the protein sequence in the Target Sequence pop-up menu, double click within the protein sequence. A window containing the protein sequence will appear. If you select a nucleotide sequence in the Target Sequence pop-up menu, double click within the CDS (coding sequence) feature to launch the Coding Region feature form (see Features in the Sequin help documentation). Click on "Launch Product Viewer" to start the sequence editor. Both methods of accessing the protein sequence editor will result in the same display window.
The cursor can be moved with the mouse or the arrow keys. The display window will change to show the position of the cursor. The sequence location of the first residue on each line is indicated on the left side of the window. The cursor location, or the range of sequences selected by the mouse, is shown in the upper left corner of the window. If you want to move the cursor to a specific location, type the number in the box on the top left of the sequence editor window, and hit the Go to button. If you want to look at a specific sequence, but not move the cursor to it, type the number in the upper right box of the window and hit the Look at button.
Select a piece of sequence by highlighting it with the mouse. To select the entire sequence, click on a sequence location number on the left side of the window. Any sequence that is highlighted in the Sequence Editor will show up as a box on the sequence when it is viewed in the Graphic Display Format.
One way to insert and delete residues is with the mouse. Move the cursor to the appropriate location and type. Text will be inserted to the left of the cursor. Delete sequence with the backspace or delete key. Text will be deleted to the left of the cursor. To delete a block of sequence, highlight it with the mouse and use the delete or backspace key.
Another way to insert and delete residues is with options under the Edit menu of the Sequence Editor. Use Cut to remove, or Copy to copy, highlighted residues. Paste these sequences anywhere. Use Clear to permanently remove highlighted residues.
To save changes you have made to the sequence, press the Accept button at the bottom of the Sequence Editor display window. If you do not want to save the changes, press the Cancel button at the bottom of the Sequence Editor display window. Selecting either Accept or Cancel will quit the Sequence Editor and return you to the record viewer. Please note that any changes you make will not become a permanent part of the Sequin record until you Save the record in the record viewer. The Save button at the bottom of the Sequence Editor display window is used only to save a CDS feature.
The default sequence displayed for a nucleotide sequence is the coding strand. If you would like to see the complement of this sequence, that is, if you would like to see the double-stranded version of this sequence, select Complement under the Sequence Editor View menu. You can also elect to see the translation of the top stand. Select Reading Frames + under the Sequence Editor View menu to see the three phase translation of the upper (coding) nucleotide strand. Select Reading Frames - under the Sequence Editor View menu to see the three phase translation of the lower (noncoding) nucleotide strand. Methionine residues are colored. Complement, Reading Frames +, and Reading Frames - can be selected simultaneously or individually.
Only the top nucleotide strand can be edited. Any changes made in this strand are reflected in the Complement as well as in the Reading Frames.
A powerful feature of the Sequence editor is that it allows you to make new CDS (coding sequence) features on the nucleotide sequence. To make a new CDS feature, select the residues, and choose Features-->Coding Regions and Transcripts-->CDS. This action launches the CDS editor. The location of the highlighted sequenced will have been automatically filled out in the Location page. Visit the Location page, enter the protein name on the Coding Region-->Protein subpage, and press Accept. Select "Show Features" at the bottom of the Sequence Editor to see the CDS as a colored bar. The CDS can be selected by clicking either on it or on its name in the left margin. To remove a CDS, select it and click on Clear under the Sequin Edit menu. Click on yes when Sequin asks if you want to delete the associated protein product.
You can also have Sequin find coding sequences for you by using the ORF Finder, located under the Search menu of the record viewer. Click on ORF Finder to find the ORFs (open reading frames) in your sequence. The ORF Finder is described in more detail above. In the ORF Finder, click on the ORF you want to add to the sequence. This ORF will be highlighted on the sequence when it is viewed in the sequence editor. You can then make the sequence into a CDS by following the above instructions. Coding Region (CDS) feature form. At minimum, enter the name of the protein on the Protein subpage of the Coding Region page. For more detailed instructions, see the CDS feature, above. After you click Accept on the Coding Region form, Sequin will accept the CDS as a new feature, and the record viewer and other windows will be brought up to date. The color of the CDS will change to pink. A graphical representation of features can be seen by selecting the Graphic Display Format in the record viewer.
Saved CDS features can also be edited. You can alter the length or location of a saved CDS as described above. However, a saved CDS cannot be removed in the Sequence Editor window. To remove a saved feature, go to the Graphic Display Format of the record viewer, select the CDS, and choose Clear under the Edit window.
When you add or remove nucleotide sequence in a region within a CDS, you can choose whether the CDS should be interrupted by these changes. On the main Sequin window, select Split feature mode to have the CDS interrupted by the inserted or deleted sequence. Select Merge feature mode to have the CDS incorporate the changed sequence.
Sequin allows you to work with aligned sets of closely related nucleotide sequences that are part of a population, phylogenetic, or mutation study. If the sequences are imported in a pre-aligned format, such as PHYLIP, Sequin uses this alignment. If the sequences are imported individually in FASTA format, Sequin can generate its own alignment.
You can view the aligned sequences in the Sequence Alignment Editor. In the record viewer, select All Sequences in the Target Sequences menu, and select the Alignment Display Format. Highlight the alignment by clicking inside of the box surrounding the sequence bars. Then select Edit alignment from the Edit menu. The aligned sequences can be viewed in a number of different formats. See instructions for the Sequence Editor Alignment menu, below.
If you imported a set of nucleotide sequences, you may want to add a CDS (coding sequence) feature to one or more of the sequences. You must first add the CDS feature to a single sequence (see Editing a CDS, above ). To access the Sequence Editor for a single sequence, double click on the name of that sequence in the Alignment view. You can then propagate the feature to other sequences (see Feature Propagate under the Edit menu).
Sequin also allows you to import sequences and align them either with an existing alignment or with a single sequence. Features can be propogated between aligned sequences. Sequences can either be in a file or in Entrez (see Sequence Editor File Menu, below).
Imports FASTA formatted sequence(s) or ASN1 records from a file. Three alignment methods are available. BLAST provides the best local alignment; BLAST with extensions provides a global alignment anchored by the BLAST local alignment; Global Alignment uses a dynamic programming algorithm to provide a different global alignment.
Imports one sequence from Entrez using the Accession number or gi.
Imports sequence alignments in PHYLIP, NEXUS, and FASTA+Gap format. The first sequence in the file has the identical sequence and Sequence Identifier as the sequence in the record.
Exports single sequences in Text or FASTA format, and alignments in FASTA+Gap, PHYLIP, or ASN1 format. This function allows you to choose the range of the sequence to export.
Closes the Sequence Editor, committing all changes made in the Sequence Editor. To save the changes, select File-->Save in the main Sequin menu.
Cancels the Sequence Editor without committing any changes.
Undoes all actions performed in the Sequence Editor since the last save.
Removes the highlighted sequence. This sequence can be pasted elsewhere.
Pastes a cut or copied sequence to the right of the cursor.
Copies the highlighted sequence. This sequence can be pasted elsewhere.
Refreshes the window by reloading the data. Note that this option does not undo any editing.
For alignments, deletes the selected sequence.
Allows viewing of the sequence, only.
Allows editing of the sequence
Allows you to change how the Sequence Identifiers are displayed. Normally, sequence identifiers are only displayed for aligned sequences. If the sequences have been downloaded from Entrez and have different names in their definition lines, you can change which name you see. You can view each sequence labeled by the following names: FASTA short, FASTA long, Locus, Accession, or Report.
Choose font
Allows you to change the style of the display, including the colors, font type, and font size.
Shows the complement of the submitted strand underneath the original.
Shows the indicated phase translation of the selected coding sequence. You can select any or all of the six reading frames.
Allows you to choose between three styles in which to view the coding sequence translation. The default style is to see all amino acids. If you select the *** option, Sequin will display all methionine residues as M and all stop codons as *. If you select the orf option, Sequin will show all open reading frames by connecting the M and * in a single reading frame with a ~.
The Find command allows you to find DNA or amino acid sequence patterns in your sequence. The search is case insensitive. To find an exact match to a DNA sequence pattern, type the pattern in the box. You can also specify non-exact patterns. To find the reverse complement of the pattern, click on the box. For example,
TCAGGGC finds the sequence TCAGGGC
[TCA]CAGGGC finds T or C or A followed by CAGGGC
NCAGGGC finds T or C or G or A followed by CAGGGC
TCA(3)GC finds the sequence TCAGGGC
TCA(1:3)GC finds the sequences TCAGC, TCAGGC, and TCAGGGC
TCA(1:3)NC finds the sequence TCA, followed by 1-3 occurrences of G,A,T,or C, followed by C, i.e., TCATC or TCATTC or TCAATGC
To find an exact match to an amino acid sequence pattern, type that sequence in the box, and click on "translate sequence". Sequin will look for all occurrences of that pattern in all three plus strand open reading frames. The open reading frames will be shown, and the DNA sequence encoding that protein sequence will be highlighted. You can also specify non-exact patterns. For example,
CDLPEYC finds the sequence CDLPEYC
[CRQ]DLPEYC finds C or R or Q followed by DLPEYC
XDLPEYC finds any amino acid followed by DLPEYC
CDL(3)EYC finds the sequence CDLEEEYC
CDL(1:3)PE finds the sequences CDLPE, CDLPPE, and CDLPPPE
CDL(1:3)XE finds the sequence CDL, followed by 1-3 occurrences of any amino acid, followed by E, i.e., CDLAAE, CDLRSE, or CDLAPQE
Find the previous occurrence of a pattern.
Find the next occurrence of a pattern.
The Features menu changes, depending whether you are viewing a single sequence or a set of aligned sequences.
If you are viewing a single sequence, the menu contains a long list of all features that can be annotated on a sequence. These features are the same as those that are accessible through the main Sequin Annotate menu.
You can annotate features either in the Annotate menu or in the Sequence Editor. If you annotate them in the Annotate menu, you must provide the nucleotide sequence location of the feature. However, if you add features from the Sequence Editor, you do not need to know their nucleotide coordinates. Simply highlight the sequence that the feature covers, and the location of the sequence will be automatically entered in the feature location box. Additional explanations of how to annotate features are provided in the section on Features.
Theses menu choices are only available when an alignment is being edited. Alignments can be generated when a set of sequences from a phylogenetic, population, or mutation study is submitted. They can also be made by importing additional reference sequences into Sequin with the Align with option under the Sequence Editor Edit menu.
Select which of the aligned sequences should be the master sequence. Click on the desired sequence in the sequence editor, then choose Select master to change the display. By default, the master sequence is the first sequence listed. The Sequence Identifier of the master sequence is indicated in color.
Select all nucleotide sequences.
Changes the way the sequences are displayed. When Show all is selected (that is, Show substitutions is visible), the entire sequence of each entry is displayed. When Show substitutions is selected, the entire sequence of the master sequence is shown. The sequences of the aligned entries are shown as dots where they are identical to the master sequence, and letters where they are different.
Use Select Variations to highlight positions at which the sequences are different from the Reference. Use Conservation to highlight positions that are different from the Reference.
This option shows the result of a dot matrix plot between two selected sequences in the alignment. It is under development.
Moves the cursor to the indicated location.
Moves the window to the indicated location without moving the cursor.
In merge mode, any new sequence that is entered into a region spanned by an existing feature becomes part of that feature. For example, if you enter new sequence in the middle of a CDS, that sequence will be translated as part of the CDS. In split mode, the new sequence interrupts the feature. For example, if you enter new sequence in the middle of a CDS, the CDS will be interrupted by that sequence (see the location of the CDS in the record viewer).
This box toggles between hiding and showing the features on a sequence. To hide the features, click on the box when it is called Hide feat. To show features, click on the box when it is called Show feat.
Refreshes the Sequence Editor window by reloading the data. This option does not undo any editing.
Closes the Sequence Editor after saving all of the changes made to sequences and features.
Closes the Sequence Editor without saving any changes made to sequences or features.
Questions or Comments?
Write to the NCBI Service
Desk
Revised June 15, 2004